ID: 973954388

View in Genome Browser
Species Human (GRCh38)
Location 4:56048964-56048986
Sequence GCTTCCTTCTCGCGCCCTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954388_973954397 18 Left 973954388 4:56048964-56048986 CCCGGAGGGCGCGAGAAGGAAGC No data
Right 973954397 4:56049005-56049027 TGTCCCTGGGCGAAGCCGGGCGG No data
973954388_973954402 23 Left 973954388 4:56048964-56048986 CCCGGAGGGCGCGAGAAGGAAGC No data
Right 973954402 4:56049010-56049032 CTGGGCGAAGCCGGGCGGGGCGG No data
973954388_973954398 19 Left 973954388 4:56048964-56048986 CCCGGAGGGCGCGAGAAGGAAGC No data
Right 973954398 4:56049006-56049028 GTCCCTGGGCGAAGCCGGGCGGG No data
973954388_973954396 15 Left 973954388 4:56048964-56048986 CCCGGAGGGCGCGAGAAGGAAGC No data
Right 973954396 4:56049002-56049024 AGCTGTCCCTGGGCGAAGCCGGG No data
973954388_973954399 20 Left 973954388 4:56048964-56048986 CCCGGAGGGCGCGAGAAGGAAGC No data
Right 973954399 4:56049007-56049029 TCCCTGGGCGAAGCCGGGCGGGG No data
973954388_973954395 14 Left 973954388 4:56048964-56048986 CCCGGAGGGCGCGAGAAGGAAGC No data
Right 973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG No data
973954388_973954392 4 Left 973954388 4:56048964-56048986 CCCGGAGGGCGCGAGAAGGAAGC No data
Right 973954392 4:56048991-56049013 GCCTCACGCTCAGCTGTCCCTGG No data
973954388_973954394 5 Left 973954388 4:56048964-56048986 CCCGGAGGGCGCGAGAAGGAAGC No data
Right 973954394 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
973954388_973954403 26 Left 973954388 4:56048964-56048986 CCCGGAGGGCGCGAGAAGGAAGC No data
Right 973954403 4:56049013-56049035 GGCGAAGCCGGGCGGGGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954388 Original CRISPR GCTTCCTTCTCGCGCCCTCC GGG (reversed) Intergenic
No off target data available for this crispr