ID: 973954389

View in Genome Browser
Species Human (GRCh38)
Location 4:56048965-56048987
Sequence GGCTTCCTTCTCGCGCCCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954389_973954394 4 Left 973954389 4:56048965-56048987 CCGGAGGGCGCGAGAAGGAAGCC No data
Right 973954394 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
973954389_973954398 18 Left 973954389 4:56048965-56048987 CCGGAGGGCGCGAGAAGGAAGCC No data
Right 973954398 4:56049006-56049028 GTCCCTGGGCGAAGCCGGGCGGG No data
973954389_973954396 14 Left 973954389 4:56048965-56048987 CCGGAGGGCGCGAGAAGGAAGCC No data
Right 973954396 4:56049002-56049024 AGCTGTCCCTGGGCGAAGCCGGG No data
973954389_973954404 30 Left 973954389 4:56048965-56048987 CCGGAGGGCGCGAGAAGGAAGCC No data
Right 973954404 4:56049018-56049040 AGCCGGGCGGGGCGGCGGCGCGG No data
973954389_973954403 25 Left 973954389 4:56048965-56048987 CCGGAGGGCGCGAGAAGGAAGCC No data
Right 973954403 4:56049013-56049035 GGCGAAGCCGGGCGGGGCGGCGG No data
973954389_973954397 17 Left 973954389 4:56048965-56048987 CCGGAGGGCGCGAGAAGGAAGCC No data
Right 973954397 4:56049005-56049027 TGTCCCTGGGCGAAGCCGGGCGG No data
973954389_973954402 22 Left 973954389 4:56048965-56048987 CCGGAGGGCGCGAGAAGGAAGCC No data
Right 973954402 4:56049010-56049032 CTGGGCGAAGCCGGGCGGGGCGG No data
973954389_973954399 19 Left 973954389 4:56048965-56048987 CCGGAGGGCGCGAGAAGGAAGCC No data
Right 973954399 4:56049007-56049029 TCCCTGGGCGAAGCCGGGCGGGG No data
973954389_973954395 13 Left 973954389 4:56048965-56048987 CCGGAGGGCGCGAGAAGGAAGCC No data
Right 973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG No data
973954389_973954392 3 Left 973954389 4:56048965-56048987 CCGGAGGGCGCGAGAAGGAAGCC No data
Right 973954392 4:56048991-56049013 GCCTCACGCTCAGCTGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954389 Original CRISPR GGCTTCCTTCTCGCGCCCTC CGG (reversed) Intergenic
No off target data available for this crispr