ID: 973954390

View in Genome Browser
Species Human (GRCh38)
Location 4:56048967-56048989
Sequence GGAGGGCGCGAGAAGGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954372_973954390 30 Left 973954372 4:56048914-56048936 CCTGGTTTCTGGGCACCCCTGGG No data
Right 973954390 4:56048967-56048989 GGAGGGCGCGAGAAGGAAGCCGG No data
973954382_973954390 -1 Left 973954382 4:56048945-56048967 CCATCTGGTGTGCGCCACTCCCG No data
Right 973954390 4:56048967-56048989 GGAGGGCGCGAGAAGGAAGCCGG No data
973954381_973954390 13 Left 973954381 4:56048931-56048953 CCTGGGGAGGGGAGCCATCTGGT No data
Right 973954390 4:56048967-56048989 GGAGGGCGCGAGAAGGAAGCCGG No data
973954379_973954390 14 Left 973954379 4:56048930-56048952 CCCTGGGGAGGGGAGCCATCTGG No data
Right 973954390 4:56048967-56048989 GGAGGGCGCGAGAAGGAAGCCGG No data
973954378_973954390 15 Left 973954378 4:56048929-56048951 CCCCTGGGGAGGGGAGCCATCTG No data
Right 973954390 4:56048967-56048989 GGAGGGCGCGAGAAGGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954390 Original CRISPR GGAGGGCGCGAGAAGGAAGC CGG Intergenic