ID: 973954393

View in Genome Browser
Species Human (GRCh38)
Location 4:56048992-56049014
Sequence CCCAGGGACAGCTGAGCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954393_973954408 25 Left 973954393 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
Right 973954408 4:56049040-56049062 GGTCCGAGCGCCCGAGGCGCCGG No data
973954393_973954405 4 Left 973954393 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
Right 973954405 4:56049019-56049041 GCCGGGCGGGGCGGCGGCGCGGG No data
973954393_973954403 -2 Left 973954393 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
Right 973954403 4:56049013-56049035 GGCGAAGCCGGGCGGGGCGGCGG No data
973954393_973954399 -8 Left 973954393 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
Right 973954399 4:56049007-56049029 TCCCTGGGCGAAGCCGGGCGGGG No data
973954393_973954397 -10 Left 973954393 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
Right 973954397 4:56049005-56049027 TGTCCCTGGGCGAAGCCGGGCGG No data
973954393_973954398 -9 Left 973954393 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
Right 973954398 4:56049006-56049028 GTCCCTGGGCGAAGCCGGGCGGG No data
973954393_973954402 -5 Left 973954393 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
Right 973954402 4:56049010-56049032 CTGGGCGAAGCCGGGCGGGGCGG No data
973954393_973954407 19 Left 973954393 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
Right 973954407 4:56049034-56049056 GGCGCGGGTCCGAGCGCCCGAGG No data
973954393_973954404 3 Left 973954393 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
Right 973954404 4:56049018-56049040 AGCCGGGCGGGGCGGCGGCGCGG No data
973954393_973954410 28 Left 973954393 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
Right 973954410 4:56049043-56049065 CCGAGCGCCCGAGGCGCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954393 Original CRISPR CCCAGGGACAGCTGAGCGTG AGG (reversed) Intergenic
No off target data available for this crispr