ID: 973954395

View in Genome Browser
Species Human (GRCh38)
Location 4:56049001-56049023
Sequence CAGCTGTCCCTGGGCGAAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954386_973954395 19 Left 973954386 4:56048959-56048981 CCACTCCCGGAGGGCGCGAGAAG No data
Right 973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG No data
973954388_973954395 14 Left 973954388 4:56048964-56048986 CCCGGAGGGCGCGAGAAGGAAGC No data
Right 973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG No data
973954389_973954395 13 Left 973954389 4:56048965-56048987 CCGGAGGGCGCGAGAAGGAAGCC No data
Right 973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG No data
973954391_973954395 -8 Left 973954391 4:56048986-56049008 CCGGCGCCTCACGCTCAGCTGTC No data
Right 973954395 4:56049001-56049023 CAGCTGTCCCTGGGCGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954395 Original CRISPR CAGCTGTCCCTGGGCGAAGC CGG Intergenic
No off target data available for this crispr