ID: 973954398

View in Genome Browser
Species Human (GRCh38)
Location 4:56049006-56049028
Sequence GTCCCTGGGCGAAGCCGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954388_973954398 19 Left 973954388 4:56048964-56048986 CCCGGAGGGCGCGAGAAGGAAGC No data
Right 973954398 4:56049006-56049028 GTCCCTGGGCGAAGCCGGGCGGG No data
973954391_973954398 -3 Left 973954391 4:56048986-56049008 CCGGCGCCTCACGCTCAGCTGTC No data
Right 973954398 4:56049006-56049028 GTCCCTGGGCGAAGCCGGGCGGG No data
973954389_973954398 18 Left 973954389 4:56048965-56048987 CCGGAGGGCGCGAGAAGGAAGCC No data
Right 973954398 4:56049006-56049028 GTCCCTGGGCGAAGCCGGGCGGG No data
973954386_973954398 24 Left 973954386 4:56048959-56048981 CCACTCCCGGAGGGCGCGAGAAG No data
Right 973954398 4:56049006-56049028 GTCCCTGGGCGAAGCCGGGCGGG No data
973954393_973954398 -9 Left 973954393 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
Right 973954398 4:56049006-56049028 GTCCCTGGGCGAAGCCGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954398 Original CRISPR GTCCCTGGGCGAAGCCGGGC GGG Intergenic
No off target data available for this crispr