ID: 973954404

View in Genome Browser
Species Human (GRCh38)
Location 4:56049018-56049040
Sequence AGCCGGGCGGGGCGGCGGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954393_973954404 3 Left 973954393 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
Right 973954404 4:56049018-56049040 AGCCGGGCGGGGCGGCGGCGCGG No data
973954391_973954404 9 Left 973954391 4:56048986-56049008 CCGGCGCCTCACGCTCAGCTGTC No data
Right 973954404 4:56049018-56049040 AGCCGGGCGGGGCGGCGGCGCGG No data
973954389_973954404 30 Left 973954389 4:56048965-56048987 CCGGAGGGCGCGAGAAGGAAGCC No data
Right 973954404 4:56049018-56049040 AGCCGGGCGGGGCGGCGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954404 Original CRISPR AGCCGGGCGGGGCGGCGGCG CGG Intergenic
No off target data available for this crispr