ID: 973954405

View in Genome Browser
Species Human (GRCh38)
Location 4:56049019-56049041
Sequence GCCGGGCGGGGCGGCGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973954393_973954405 4 Left 973954393 4:56048992-56049014 CCTCACGCTCAGCTGTCCCTGGG No data
Right 973954405 4:56049019-56049041 GCCGGGCGGGGCGGCGGCGCGGG No data
973954391_973954405 10 Left 973954391 4:56048986-56049008 CCGGCGCCTCACGCTCAGCTGTC No data
Right 973954405 4:56049019-56049041 GCCGGGCGGGGCGGCGGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973954405 Original CRISPR GCCGGGCGGGGCGGCGGCGC GGG Intergenic
No off target data available for this crispr