ID: 973955045

View in Genome Browser
Species Human (GRCh38)
Location 4:56055207-56055229
Sequence AATCCCTCCCCAGGTGAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973955045_973955056 14 Left 973955045 4:56055207-56055229 CCCCACTCACCTGGGGAGGGATT No data
Right 973955056 4:56055244-56055266 AAGATAAGGAGACAGGGAGCGGG No data
973955045_973955054 8 Left 973955045 4:56055207-56055229 CCCCACTCACCTGGGGAGGGATT No data
Right 973955054 4:56055238-56055260 AGAAGGAAGATAAGGAGACAGGG No data
973955045_973955057 21 Left 973955045 4:56055207-56055229 CCCCACTCACCTGGGGAGGGATT No data
Right 973955057 4:56055251-56055273 GGAGACAGGGAGCGGGAAACAGG No data
973955045_973955052 0 Left 973955045 4:56055207-56055229 CCCCACTCACCTGGGGAGGGATT No data
Right 973955052 4:56055230-56055252 GGCTGGCAAGAAGGAAGATAAGG No data
973955045_973955053 7 Left 973955045 4:56055207-56055229 CCCCACTCACCTGGGGAGGGATT No data
Right 973955053 4:56055237-56055259 AAGAAGGAAGATAAGGAGACAGG No data
973955045_973955051 -9 Left 973955045 4:56055207-56055229 CCCCACTCACCTGGGGAGGGATT No data
Right 973955051 4:56055221-56055243 GGAGGGATTGGCTGGCAAGAAGG No data
973955045_973955055 13 Left 973955045 4:56055207-56055229 CCCCACTCACCTGGGGAGGGATT No data
Right 973955055 4:56055243-56055265 GAAGATAAGGAGACAGGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973955045 Original CRISPR AATCCCTCCCCAGGTGAGTG GGG (reversed) Intergenic
No off target data available for this crispr