ID: 973958402

View in Genome Browser
Species Human (GRCh38)
Location 4:56086387-56086409
Sequence CACTTTTAGGAGCCTGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973958402_973958408 -7 Left 973958402 4:56086387-56086409 CCTACCTCAGGCTCCTAAAAGTG No data
Right 973958408 4:56086403-56086425 AAAAGTGTTGGGATTATAGGTGG No data
973958402_973958407 -10 Left 973958402 4:56086387-56086409 CCTACCTCAGGCTCCTAAAAGTG No data
Right 973958407 4:56086400-56086422 CCTAAAAGTGTTGGGATTATAGG 0: 5
1: 37
2: 679
3: 9137
4: 81878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973958402 Original CRISPR CACTTTTAGGAGCCTGAGGT AGG (reversed) Intergenic
No off target data available for this crispr