ID: 973959447

View in Genome Browser
Species Human (GRCh38)
Location 4:56095274-56095296
Sequence CAGAAGAGCCCCAACCACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973959447_973959452 17 Left 973959447 4:56095274-56095296 CCCGGGTGGTTGGGGCTCTTCTG No data
Right 973959452 4:56095314-56095336 GGGAAGACAGATAATAAACTAGG No data
973959447_973959449 -5 Left 973959447 4:56095274-56095296 CCCGGGTGGTTGGGGCTCTTCTG No data
Right 973959449 4:56095292-56095314 TTCTGAACTAACATTTTAGTTGG No data
973959447_973959450 -4 Left 973959447 4:56095274-56095296 CCCGGGTGGTTGGGGCTCTTCTG No data
Right 973959450 4:56095293-56095315 TCTGAACTAACATTTTAGTTGGG No data
973959447_973959451 -3 Left 973959447 4:56095274-56095296 CCCGGGTGGTTGGGGCTCTTCTG No data
Right 973959451 4:56095294-56095316 CTGAACTAACATTTTAGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973959447 Original CRISPR CAGAAGAGCCCCAACCACCC GGG (reversed) Intergenic
No off target data available for this crispr