ID: 973959649

View in Genome Browser
Species Human (GRCh38)
Location 4:56097068-56097090
Sequence TGGTGCACAAAGTTGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973959643_973959649 5 Left 973959643 4:56097040-56097062 CCTTGAATGGATAATAATGGATG No data
Right 973959649 4:56097068-56097090 TGGTGCACAAAGTTGGAGGTTGG No data
973959642_973959649 6 Left 973959642 4:56097039-56097061 CCCTTGAATGGATAATAATGGAT No data
Right 973959649 4:56097068-56097090 TGGTGCACAAAGTTGGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973959649 Original CRISPR TGGTGCACAAAGTTGGAGGT TGG Intergenic
No off target data available for this crispr