ID: 973960624

View in Genome Browser
Species Human (GRCh38)
Location 4:56106256-56106278
Sequence CTCATGCAGGGGAAGTCTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973960624_973960630 -6 Left 973960624 4:56106256-56106278 CCTTTAGACTTCCCCTGCATGAG No data
Right 973960630 4:56106273-56106295 CATGAGGCAGAAACGGCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973960624 Original CRISPR CTCATGCAGGGGAAGTCTAA AGG (reversed) Intergenic
No off target data available for this crispr