ID: 973961356

View in Genome Browser
Species Human (GRCh38)
Location 4:56112870-56112892
Sequence GTCCTGCTGCATCACATTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973961354_973961356 -6 Left 973961354 4:56112853-56112875 CCATGGGCCGCTAAGGGGTCCTG No data
Right 973961356 4:56112870-56112892 GTCCTGCTGCATCACATTATTGG No data
973961353_973961356 -5 Left 973961353 4:56112852-56112874 CCCATGGGCCGCTAAGGGGTCCT No data
Right 973961356 4:56112870-56112892 GTCCTGCTGCATCACATTATTGG No data
973961352_973961356 -4 Left 973961352 4:56112851-56112873 CCCCATGGGCCGCTAAGGGGTCC No data
Right 973961356 4:56112870-56112892 GTCCTGCTGCATCACATTATTGG No data
973961345_973961356 19 Left 973961345 4:56112828-56112850 CCTTTATTTCTATGCTTGGAGGG No data
Right 973961356 4:56112870-56112892 GTCCTGCTGCATCACATTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973961356 Original CRISPR GTCCTGCTGCATCACATTAT TGG Intergenic
No off target data available for this crispr