ID: 973966259

View in Genome Browser
Species Human (GRCh38)
Location 4:56165028-56165050
Sequence ATGGCCAGAAACTGCCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973966259_973966263 20 Left 973966259 4:56165028-56165050 CCCAGATGGCAGTTTCTGGCCAT No data
Right 973966263 4:56165071-56165093 GCTCTTGTTTCACTGTGTTAAGG No data
973966259_973966264 29 Left 973966259 4:56165028-56165050 CCCAGATGGCAGTTTCTGGCCAT No data
Right 973966264 4:56165080-56165102 TCACTGTGTTAAGGAAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973966259 Original CRISPR ATGGCCAGAAACTGCCATCT GGG (reversed) Intergenic
No off target data available for this crispr