ID: 973968456

View in Genome Browser
Species Human (GRCh38)
Location 4:56187204-56187226
Sequence ATCACTAATCACACTTCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 97}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973968456_973968458 7 Left 973968456 4:56187204-56187226 CCGGGTGAAGTGTGATTAGTGAT 0: 1
1: 0
2: 0
3: 8
4: 97
Right 973968458 4:56187234-56187256 AGAGTTTTGCACAGAGTGCTGGG 0: 1
1: 0
2: 3
3: 19
4: 196
973968456_973968457 6 Left 973968456 4:56187204-56187226 CCGGGTGAAGTGTGATTAGTGAT 0: 1
1: 0
2: 0
3: 8
4: 97
Right 973968457 4:56187233-56187255 GAGAGTTTTGCACAGAGTGCTGG 0: 1
1: 0
2: 1
3: 11
4: 145
973968456_973968459 8 Left 973968456 4:56187204-56187226 CCGGGTGAAGTGTGATTAGTGAT 0: 1
1: 0
2: 0
3: 8
4: 97
Right 973968459 4:56187235-56187257 GAGTTTTGCACAGAGTGCTGGGG 0: 1
1: 0
2: 2
3: 18
4: 214
973968456_973968460 18 Left 973968456 4:56187204-56187226 CCGGGTGAAGTGTGATTAGTGAT 0: 1
1: 0
2: 0
3: 8
4: 97
Right 973968460 4:56187245-56187267 CAGAGTGCTGGGGAACACAAAGG 0: 1
1: 0
2: 2
3: 24
4: 260
973968456_973968461 19 Left 973968456 4:56187204-56187226 CCGGGTGAAGTGTGATTAGTGAT 0: 1
1: 0
2: 0
3: 8
4: 97
Right 973968461 4:56187246-56187268 AGAGTGCTGGGGAACACAAAGGG 0: 1
1: 0
2: 4
3: 30
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973968456 Original CRISPR ATCACTAATCACACTTCACC CGG (reversed) Intronic
901202017 1:7472445-7472467 ACCACGCACCACACTTCACCTGG + Intronic
903477026 1:23626584-23626606 ATCTCTCATCACACATCACTAGG - Intronic
905545402 1:38794413-38794435 AGCACTAATCCCATTTGACCAGG + Intergenic
909028441 1:70510245-70510267 ATCACTATTGACTCTTCCCCTGG - Intergenic
911456482 1:98130632-98130654 TTTACTGATCACACTTCATCAGG + Intergenic
912841063 1:113039531-113039553 ATCACTAATGGCACTTCATATGG - Intergenic
913350479 1:117852877-117852899 ATTACTAAACTCCCTTCACCAGG + Intergenic
913586599 1:120280562-120280584 CTCATTTATCACACTTCTCCAGG - Intergenic
913621587 1:120617808-120617830 CTCATTTATCACACTTCTCCAGG + Intergenic
914568613 1:148892425-148892447 CTCATTTATCACACTTCTCCAGG - Intronic
914604213 1:149237827-149237849 CTCATTTATCACACTTCTCCAGG + Intergenic
917071458 1:171155822-171155844 ATCATTAATGACACTTCATATGG - Intronic
919054060 1:192547003-192547025 ATCACTTATCAGATTTAACCAGG + Intergenic
1066340866 10:34531780-34531802 ATCACTAGTGGCACTTCACATGG + Intronic
1067196064 10:44119343-44119365 ATCACTAGTGGCACTTCACGTGG - Intergenic
1074511733 10:114118636-114118658 CTCACTATTCACTCTCCACCAGG + Intergenic
1074987948 10:118673923-118673945 CTCACTAATCATACCTCCCCCGG - Intergenic
1077241553 11:1512989-1513011 ATCCCTAATCACCCCCCACCAGG - Intergenic
1081631249 11:44691487-44691509 ATCCCTAATTAAACTTCACATGG + Intergenic
1083950327 11:65951438-65951460 ATCACTAATCACTAATCATCTGG - Intronic
1090563454 11:127959617-127959639 CTCACTCTTCACTCTTCACCTGG + Intergenic
1096940479 12:55339051-55339073 GTCACTAGTGACACTTCACATGG + Intergenic
1097678215 12:62625051-62625073 TTCACTAATAAAACTTAACCAGG + Intergenic
1098542518 12:71672793-71672815 ATCACTAATGGCACTTCATATGG + Intronic
1102949886 12:117024373-117024395 AGCACTAATCAGCCTGCACCAGG + Intronic
1106872062 13:34032266-34032288 TTCACTGATCTCAGTTCACCGGG + Intergenic
1108168814 13:47720178-47720200 ATCAGAAATCACACTTTGCCTGG + Intergenic
1108841997 13:54629515-54629537 ATCAGCATCCACACTTCACCAGG - Intergenic
1112301942 13:98239008-98239030 ACCACTAATCAGACTTTCCCAGG - Intronic
1114619335 14:24085693-24085715 ATCACTTATAAAACTTAACCTGG + Intronic
1115283155 14:31687759-31687781 ATCACTAGTGGCACTTCACATGG - Intronic
1123688197 15:22815365-22815387 AGCATGAATCACACTGCACCTGG - Intronic
1131146083 15:90013400-90013422 ATCAAAAATCACACAACACCTGG - Intronic
1131213616 15:90518798-90518820 AGCTCTGATCACACTTCACTGGG + Intergenic
1137519275 16:49178341-49178363 ACCACTAAGGACACCTCACCAGG + Intergenic
1149756407 17:59190140-59190162 ATCACTAATCTCAATGTACCAGG + Intronic
1152807445 17:82362859-82362881 CTCACCACCCACACTTCACCAGG - Exonic
1155081176 18:22411370-22411392 AACACTAATCTCACTTCAAAGGG - Intergenic
1164796677 19:31039343-31039365 ATCAGTAATCACAGGTCAGCTGG + Intergenic
1165926626 19:39330291-39330313 ATCACTGGTCACAGTGCACCTGG - Intronic
1165985198 19:39762559-39762581 ATCACTACTCACATTTCTTCTGG - Intergenic
1167028825 19:46942955-46942977 ATCAATAGTCACACTGCACTTGG + Intronic
925463816 2:4088619-4088641 ATCACTACTCACCCTTCAGTTGG - Intergenic
930736451 2:54785052-54785074 ATCACTAGTGGCACTTCACAGGG + Intronic
931529322 2:63196157-63196179 ATCACTAGTGGCACTTCACAGGG - Intronic
933712722 2:85339270-85339292 AATAGAAATCACACTTCACCGGG - Intergenic
935139454 2:100339852-100339874 ATCACTAGACACAATGCACCTGG - Intergenic
939766990 2:146262887-146262909 ATCATTCATCACACTTCATCAGG - Intergenic
942205765 2:173618765-173618787 ATCACTAATTCCTCTTGACCAGG + Intergenic
943378146 2:187107158-187107180 ATCACTAGTGGCACTTCATCTGG + Intergenic
943540750 2:189211011-189211033 ATAACTAAGCAGACTTCACTTGG + Intergenic
945630829 2:212274296-212274318 ATCACTAGTGACACTTCATATGG + Intronic
946398959 2:219458674-219458696 ATCACTAAGCCCCCTTCACTGGG - Intronic
1175741629 20:61423727-61423749 ATCATTAATAACACTTCCTCAGG + Intronic
1176973716 21:15293989-15294011 AATAATAATCACACTTCTCCTGG + Intergenic
1180246465 21:46551289-46551311 ATCACTAAATACATTTCATCAGG + Intronic
1181622165 22:24098543-24098565 ATCACTAAGCTGACTGCACCAGG - Intronic
1182524006 22:30904188-30904210 ATTACTAAGCACACTACACTGGG - Intronic
949459080 3:4271140-4271162 ACCACCAATCACATTTCATCAGG + Intronic
949585039 3:5428905-5428927 ATTAATCATCACACTTCAACTGG - Intergenic
949717819 3:6953652-6953674 ATCACACATCACATCTCACCAGG + Intronic
953108232 3:39906938-39906960 ACCCCTAATCACACTGAACCTGG - Intronic
954937737 3:54342526-54342548 GTCACCAATCACACTGTACCCGG - Intronic
955737171 3:62051628-62051650 ATCACGTATCAGAATTCACCTGG - Intronic
956150761 3:66240000-66240022 ATCACTAGTGGCACTTCATCTGG + Intronic
957568524 3:81915957-81915979 TTCACTAATCACTCTGCAGCTGG - Intergenic
958761137 3:98309868-98309890 ATCTCTAAGCACACCTCACCTGG + Intergenic
959319683 3:104855876-104855898 ACCACAAATCACTCTTCACTGGG + Intergenic
961529230 3:127529760-127529782 ATCACAAATCACTCCACACCAGG + Intergenic
973968456 4:56187204-56187226 ATCACTAATCACACTTCACCCGG - Intronic
974990506 4:69082043-69082065 ATCACCAATCACAGATCACCAGG - Intronic
977803219 4:101263900-101263922 ATCACTCTTCTCACTTTACCAGG + Intronic
983483786 4:168309265-168309287 ATCACTAATGGCACTTCATATGG - Intronic
984583542 4:181536907-181536929 ATCACTGAGCAGAGTTCACCAGG - Intergenic
992547956 5:77833584-77833606 AAAACAAATCACACTACACCTGG - Intronic
996421155 5:123264222-123264244 ATCAAGAATGATACTTCACCTGG - Intergenic
999069642 5:148730354-148730376 ATCACTCATCATGCTTCACCAGG - Intergenic
1006389256 6:33748908-33748930 CTGACTGATCACATTTCACCAGG + Intergenic
1007350641 6:41271171-41271193 ATCACGGATCACCCTACACCTGG + Intronic
1010795856 6:80115566-80115588 ATCATTCATCATACTTCACCAGG + Intronic
1013097569 6:106959737-106959759 AACAGTGATCACATTTCACCTGG + Intergenic
1013999776 6:116351843-116351865 GTCACTATTCATAGTTCACCAGG - Intronic
1014926186 6:127273098-127273120 ATCACTAGTGGCACTTCACATGG + Intronic
1015810794 6:137160271-137160293 AACAGTAATAACACTGCACCAGG + Intronic
1015867789 6:137744884-137744906 ATCACTTACCAGACTTGACCGGG + Intergenic
1028379286 7:90180427-90180449 ATTTCTAACCACACTTCACCTGG - Intronic
1028894040 7:96020983-96021005 ATCCCTCATCACTCTTCACCAGG - Intronic
1029962909 7:104707490-104707512 TACACTAGTCACACTTCAACTGG + Intronic
1030028257 7:105345861-105345883 CACACTAGTCACACTTCACATGG + Intronic
1031060842 7:117049837-117049859 ATCACTAGTGACACTTCATATGG + Intronic
1040886375 8:52267747-52267769 TTCTCTCAACACACTTCACCTGG + Intronic
1040910799 8:52516643-52516665 CTCAGTAATAACATTTCACCTGG + Intergenic
1042237788 8:66631277-66631299 GTCATTAATTACACTTCAACTGG - Exonic
1043169445 8:76947068-76947090 ATTACTAGTCACACTTCATATGG - Intergenic
1045380070 8:101615108-101615130 ACCACACATCAGACTTCACCGGG - Intronic
1045832299 8:106477147-106477169 ATCACTAATTACACTTTATATGG + Intronic
1046099751 8:109600966-109600988 ATCTCTAGTAACACATCACCTGG + Intronic
1046969747 8:120209023-120209045 AACACTAATCACAATGCGCCAGG + Intronic
1048641526 8:136368640-136368662 ATGACTAATCCCACTTCATGGGG + Intergenic
1050475193 9:6033852-6033874 ACCTGTAATCACACTACACCTGG - Intergenic
1050968112 9:11834655-11834677 ATTAATAATTACACTTTACCTGG + Intergenic
1187005289 X:15226779-15226801 ATCACTAAACACATTTCTCTAGG + Intergenic
1189781276 X:44516497-44516519 GTCAGTAATCACACTTCAAAAGG - Intergenic
1192330546 X:70171930-70171952 ATCATGAATCACACTTCATCAGG + Intergenic
1193197867 X:78655695-78655717 ACCACTCCTCACACCTCACCTGG + Intergenic
1193454751 X:81717150-81717172 GACACTAGTCACACTGCACCAGG + Intergenic