ID: 973968488

View in Genome Browser
Species Human (GRCh38)
Location 4:56187488-56187510
Sequence TAGGCTTGATCCAAAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 136}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973968488_973968489 -10 Left 973968488 4:56187488-56187510 CCAGCAGCTTTGGATCAAGCCTA 0: 1
1: 0
2: 0
3: 13
4: 136
Right 973968489 4:56187501-56187523 ATCAAGCCTATAGACTGTACAGG No data
973968488_973968493 29 Left 973968488 4:56187488-56187510 CCAGCAGCTTTGGATCAAGCCTA 0: 1
1: 0
2: 0
3: 13
4: 136
Right 973968493 4:56187540-56187562 CGATCATCTTAGTACTTCTAGGG 0: 1
1: 0
2: 0
3: 2
4: 52
973968488_973968492 28 Left 973968488 4:56187488-56187510 CCAGCAGCTTTGGATCAAGCCTA 0: 1
1: 0
2: 0
3: 13
4: 136
Right 973968492 4:56187539-56187561 ACGATCATCTTAGTACTTCTAGG 0: 1
1: 0
2: 0
3: 1
4: 67
973968488_973968494 30 Left 973968488 4:56187488-56187510 CCAGCAGCTTTGGATCAAGCCTA 0: 1
1: 0
2: 0
3: 13
4: 136
Right 973968494 4:56187541-56187563 GATCATCTTAGTACTTCTAGGGG 0: 1
1: 0
2: 0
3: 11
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973968488 Original CRISPR TAGGCTTGATCCAAAGCTGC TGG (reversed) Intronic
901350328 1:8589761-8589783 AAGGCTTGAGCCCAAGCTGAGGG + Intronic
903589053 1:24440516-24440538 TTGCCTTGCTGCAAAGCTGCTGG + Intronic
903775597 1:25791519-25791541 GAGGCTTGATCCACGGCTACAGG - Intergenic
904688716 1:32277896-32277918 TAGGCTTGAGCCACAGCACCTGG - Intronic
905621763 1:39454521-39454543 TAGGCGTGATCCACTGCTCCCGG - Intronic
905909127 1:41641745-41641767 GAGGGTTGACCCAGAGCTGCAGG - Intronic
907895771 1:58689418-58689440 TAGACTGGATACAAAGCAGCAGG + Intronic
908177050 1:61566115-61566137 AAGGCTAGAACCAGAGCTGCTGG + Intergenic
911272008 1:95813271-95813293 GAGGCCTGATCCAAAAATGCAGG + Intergenic
914516505 1:148379189-148379211 TCGCCTTCATCAAAAGCTGCCGG + Intergenic
919329503 1:196152210-196152232 TGGGCTTGACTCCAAGCTGCAGG + Intergenic
919395008 1:197035313-197035335 TAGGCTTGAGCCACAGCGCCCGG + Intergenic
923517789 1:234712061-234712083 TAGGCCTGATCCCAAAGTGCTGG + Intergenic
1066429880 10:35341310-35341332 CAGGCTTGAACCAAGGCTGCAGG - Intronic
1066669324 10:37820351-37820373 TCGGCTTGACCCAGAGCAGCTGG - Intronic
1069191817 10:65501363-65501385 TAGTCTAGATCAAAGGCTGCTGG - Intergenic
1069333442 10:67320445-67320467 TAGGCTTGCACCCAAGCTGCTGG - Intronic
1070732116 10:78837244-78837266 TGGGCTTGGTTCCAAGCTGCAGG - Intergenic
1071424212 10:85532115-85532137 TAGCCTTGAACAAAAGCAGCAGG + Intergenic
1076645379 10:131950525-131950547 AAGGCTTGATTCTAAGCTGGCGG - Intronic
1078883475 11:15476682-15476704 TAGGCTTGATTGAAAGTGGCAGG + Intergenic
1079732882 11:23958007-23958029 TAGGCTTGATAAAATGCTGATGG - Intergenic
1085650034 11:78259508-78259530 AAGACTGGATCCAAAGCTCCAGG + Intronic
1086262934 11:84962274-84962296 CAGACTTGAACCCAAGCTGCTGG + Intronic
1088915344 11:114223494-114223516 TGGGCTTGAGCCAGAGCTCCAGG - Intronic
1089083267 11:115795431-115795453 TGGGCTTGACCCAAAGCTTCTGG + Intergenic
1089971937 11:122700772-122700794 TAGGCATGAGCCAAAGCACCTGG + Intronic
1090783040 11:130024199-130024221 TAGGCTTGAGCCACAGCGCCCGG + Intergenic
1097611194 12:61823392-61823414 TGGCTTTGATCCAAAGATGCAGG - Intronic
1100080130 12:90838918-90838940 TAAGGTTACTCCAAAGCTGCCGG - Intergenic
1103745924 12:123123655-123123677 TAGGCATGAGCCAATGCTCCCGG - Intronic
1103960333 12:124605456-124605478 AAGGCTTAATCCAGAACTGCAGG - Intergenic
1108186075 13:47889653-47889675 TAGGCTTGAGCCAATGCACCTGG - Intergenic
1109666154 13:65541044-65541066 CAGGCTTGAGCCACAGCTCCTGG - Intergenic
1110514544 13:76394194-76394216 TAGGCATGAGCCAAAGCACCCGG + Intergenic
1111875769 13:93893331-93893353 TAGGCATGATCCACCGCTCCCGG + Intronic
1114519986 14:23327295-23327317 TAGGCGTGAGCCACAGCTCCTGG + Intergenic
1117551946 14:56845414-56845436 CAGGCTTGATCCACTGCTCCCGG + Intergenic
1118228897 14:63929491-63929513 TAGGCATGAGCCACAGCGGCTGG - Intronic
1119898579 14:78241350-78241372 CAGGCATGAGCCACAGCTGCTGG - Intergenic
1130521141 15:84661532-84661554 TGGGCTACATCCAAAGCTACTGG + Intergenic
1134029410 16:10979718-10979740 GGGGCTTCATTCAAAGCTGCAGG - Intronic
1136509534 16:30727957-30727979 TAGGCTTGAGCCACTGCTCCTGG + Intronic
1137378579 16:47976467-47976489 TAAACTTGATCCAGTGCTGCAGG - Intergenic
1139865209 16:70056240-70056262 TAGGCATGAGCCACCGCTGCCGG - Intergenic
1141111594 16:81275114-81275136 TGGGGTGGAGCCAAAGCTGCTGG - Intronic
1141511637 16:84515890-84515912 TAGGCTTGAGCCACTGCTCCTGG - Intronic
1141876717 16:86829930-86829952 CAGGCCTCATTCAAAGCTGCAGG - Intergenic
1147155692 17:38543618-38543640 TAATCTAGATCCAAAGCTCCGGG + Intronic
1148011486 17:44485389-44485411 TAGGCTTGAGCCACAGCGCCTGG + Intronic
1151422639 17:74008472-74008494 CAGCCTTGATCACAAGCTGCAGG + Intergenic
1151598593 17:75092984-75093006 CATGCTTTCTCCAAAGCTGCTGG + Intronic
1152939596 17:83161236-83161258 TAGGATTCAGCCGAAGCTGCCGG + Intergenic
1153930004 18:9869973-9869995 AAGGTCTGATCCAAAACTGCTGG + Intergenic
1154122557 18:11663700-11663722 GAGGCTTCATGCAAAGCTGGGGG + Intergenic
1159691667 18:71495710-71495732 TAGGCTTGAGCCACCGCTCCCGG + Intergenic
1160125050 18:76164171-76164193 CAGAGTTGATCCAAAGCTGTTGG - Intergenic
1162475893 19:10899190-10899212 TGGGCTTGGGCCAAAGATGCCGG - Intronic
1164537705 19:29098703-29098725 GAGGCTTGCTGCAAACCTGCCGG - Intergenic
927143887 2:20148031-20148053 TAGGCGTGAGCCACAGCTCCTGG + Intergenic
929158889 2:38812034-38812056 TAGGCATGAGCCAATGCTCCTGG + Intronic
930896174 2:56449226-56449248 TGGGCTTCATCCAGAGCTGGAGG + Intergenic
932942474 2:76184238-76184260 TAGGCTTGAGCCAATGCGCCAGG - Intergenic
936977758 2:118236471-118236493 TTGGCTTGATCATAAGCTGCTGG + Intergenic
946922057 2:224590664-224590686 TAGGTTTGATGTAAAGTTGCTGG - Intergenic
947813678 2:233021844-233021866 TAGTCTTGAGCCACAGATGCGGG - Intergenic
947973949 2:234347880-234347902 TGGGTTTACTCCAAAGCTGCTGG + Intergenic
1172812641 20:37660106-37660128 TAGGCATGAGCCAAAGCACCTGG + Intergenic
1178364385 21:31976742-31976764 TAGGCGTGAGCCAAAGCACCTGG + Intronic
1179962020 21:44772942-44772964 TTGGCTGGAGCCAAGGCTGCAGG - Intronic
1181348383 22:22237515-22237537 TAGGCATGAGCCATAGCTCCTGG - Intergenic
1181774034 22:25146946-25146968 TAGGTTTGCTCCAACCCTGCAGG - Intronic
1182390649 22:29992342-29992364 TAGGCGTGAGCCACAGCTCCTGG + Intronic
1184348942 22:43930638-43930660 TAGCTTTGTTCAAAAGCTGCTGG + Intronic
1184441364 22:44518542-44518564 CAGGCTTGACTCTAAGCTGCAGG + Intergenic
1185022074 22:48382414-48382436 CAGGAATGATCCACAGCTGCCGG + Intergenic
950399961 3:12762246-12762268 TAGGCATGAGCCAAAGCACCTGG + Intronic
951958908 3:28292489-28292511 TAGGCTTGATCATAAGCAGTGGG - Intronic
953064981 3:39460550-39460572 TAGGCTTCCTCCACTGCTGCGGG + Intergenic
953961356 3:47268438-47268460 TAGGCTTGCTCCACAGCCTCAGG - Intronic
954797620 3:53169487-53169509 TAGACATGATCCAAAGCTTCCGG - Intronic
956816675 3:72914356-72914378 CATGCCTGATCCCAAGCTGCCGG - Intronic
957270400 3:78023323-78023345 TAGGCGTGAGCCAACGCTCCCGG + Intergenic
957335481 3:78822373-78822395 TTGGCTTGATTCAAGGCAGCTGG - Intronic
962823891 3:139081297-139081319 TGGGCTTGGTCCACTGCTGCAGG + Intronic
962979279 3:140473211-140473233 GAGGCATGATGAAAAGCTGCAGG - Intronic
963311165 3:143711700-143711722 TAGGCATGAGCCACAGCTCCAGG + Intronic
968875257 4:3263300-3263322 TAGCTTAGTTCCAAAGCTGCAGG - Intronic
968948046 4:3675902-3675924 TATGCTGGCTCCACAGCTGCGGG - Intergenic
970430274 4:15982748-15982770 AAGGCTTCAGCCAAAGCTGGCGG + Intronic
973968488 4:56187488-56187510 TAGGCTTGATCCAAAGCTGCTGG - Intronic
974039123 4:56842920-56842942 TAGGCTTGAGCCACAGCTCCTGG - Intergenic
976141483 4:81997713-81997735 TCGGCATGATCCACAGTTGCAGG + Intronic
977200224 4:94106545-94106567 GAGGCTTGATCAAAATCAGCAGG + Intergenic
979318926 4:119300542-119300564 TAGGGTTGTTACGAAGCTGCAGG - Exonic
981338532 4:143593897-143593919 GAGGCTTGAGCCAAAGCGGCTGG - Intronic
982417778 4:155157235-155157257 AAGGCTGGAGCCACAGCTGCTGG - Intergenic
983983194 4:174024427-174024449 GGGGCTTGATCCAATGTTGCCGG - Intergenic
985432450 4:189894062-189894084 TAGGCATGATCCCCTGCTGCGGG - Intergenic
985854504 5:2414285-2414307 CAGGCATGAGCCACAGCTGCTGG + Intergenic
986409013 5:7457672-7457694 TAGCCTTGATCCTGATCTGCAGG - Intronic
991717743 5:69467427-69467449 TAGGCCTGAGCCACAGCAGCTGG + Intergenic
992108609 5:73471398-73471420 CAGGCTTGAGCCACAGCAGCTGG + Intergenic
992584729 5:78225589-78225611 TAGCCTTGATCCAGAGCAGAAGG - Exonic
993098800 5:83511361-83511383 AAGGCTTTATCCAAAGAGGCTGG + Intronic
993682636 5:90898732-90898754 TAGGCTTGGTCTCAAACTGCTGG - Intronic
995433763 5:112112367-112112389 CAGGCTTGACACAAAGCTGTGGG + Intergenic
999276832 5:150337124-150337146 CAGGCTTGATCCAGAACTACTGG + Intronic
999551964 5:152699027-152699049 CAGGCGTGATCCACAGCTCCTGG + Intergenic
1001994735 5:176147372-176147394 TAGGTTTGACCCAAAACAGCAGG + Intergenic
1002722582 5:181272380-181272402 TAGGTTTGACCCAAAACAGCAGG - Intergenic
1004060579 6:12193093-12193115 TAGGCGTGAGCCACAGCAGCTGG + Intergenic
1004132743 6:12935995-12936017 TAGCCTTGATCAAAAGCTCTAGG - Intronic
1005885714 6:30096100-30096122 CAGGCTTGAGCCAACGCTTCCGG - Intergenic
1006345189 6:33475352-33475374 TAGGCGTGAGCCACAGCTCCTGG - Intergenic
1012336784 6:98069693-98069715 TGGGCTTCATCCTAAGCTTCAGG - Intergenic
1013164391 6:107576642-107576664 TGGGCTCAAGCCAAAGCTGCAGG + Intronic
1017756481 6:157533554-157533576 CTGGCTTGTTCCAGAGCTGCAGG + Intronic
1018345598 6:162896041-162896063 CAGGCCTGATCTAAGGCTGCTGG - Intronic
1020053906 7:5103599-5103621 CTGGCTTGATCCAAAGCCCCAGG - Intergenic
1023711186 7:42994605-42994627 CAGGCATGATCCAATGCGGCCGG + Intergenic
1024183056 7:46916849-46916871 TTGCCTGGAACCAAAGCTGCTGG - Intergenic
1027225219 7:76239416-76239438 TAGGCATGAGCCACAGCGGCTGG - Intronic
1028063863 7:86356371-86356393 TAGGCGTGAGCCACTGCTGCTGG - Intergenic
1028163195 7:87508978-87509000 TTGTCTTGATCCAAAGCTATAGG - Intronic
1032063309 7:128743779-128743801 CAGGCTTGAGCCACTGCTGCTGG + Intronic
1032396993 7:131597604-131597626 TAGGCTTGAGCCACTGCTCCCGG + Intergenic
1033601528 7:142892284-142892306 TGGGCTTCCTCCAAAGCTTCAGG - Intergenic
1033903576 7:146173927-146173949 CAGGCTTGAGCCACAGCTCCTGG - Intronic
1034058338 7:148060393-148060415 TAGAATTGATCAAAAGCTTCAGG - Intronic
1038201417 8:25416435-25416457 TAGGCTTGAGCCACAGCTCCTGG - Intronic
1038415591 8:27392849-27392871 TAGGTTTGATCAAAAGCCTCAGG - Intronic
1041811111 8:61911273-61911295 TCGGCTTTCTCCAAAGCTGCAGG + Intergenic
1042030381 8:64469705-64469727 GAAGCTTGATCCTATGCTGCTGG + Intergenic
1047688879 8:127330427-127330449 AGGGCTTGACCCAAAGCTACTGG - Intergenic
1049335063 8:142079902-142079924 CAGGCTTGCTCCAGAGCAGCTGG + Intergenic
1050272390 9:3959872-3959894 CAGGCTTGAGCCAAGGCTCCCGG - Intronic
1050486866 9:6143622-6143644 TGGGCTTGATTCCAAGCTGCAGG + Intergenic
1051485515 9:17604064-17604086 TACGCTTGTTACAAAACTGCTGG + Intronic
1055043016 9:71895818-71895840 TAGGCTTGACCCCAAGCTGTTGG - Intronic
1055921083 9:81461775-81461797 TAGGCATGAGCCAAAGCACCAGG - Intergenic
1056031789 9:82560904-82560926 GAGGCTTGATCAAAAGCTGATGG + Intergenic
1057434896 9:95031063-95031085 TAGGCTTGATCCCAGGCTAGTGG + Intronic
1061440439 9:130599625-130599647 ATGGCCTGATCCAAAGCTGGAGG - Intronic
1186515479 X:10163681-10163703 TAGGCTTGAGCCACTGCTCCCGG + Intronic
1187457378 X:19454197-19454219 TAGTCTCGATCCAAAGATGCTGG + Intronic
1190584004 X:51919226-51919248 TAATCTTGGTGCAAAGCTGCAGG - Intergenic
1191888171 X:65910882-65910904 TAGGCATGAGCCAAAGCACCCGG + Intergenic
1196093431 X:111772268-111772290 TAGTTTTGAGGCAAAGCTGCAGG + Intergenic
1196975306 X:121152366-121152388 TAGGTGTGATCCAAAGCAGTAGG + Intergenic