ID: 973969188

View in Genome Browser
Species Human (GRCh38)
Location 4:56194207-56194229
Sequence GGCTTACAAATGCCCGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 96}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973969188 Original CRISPR GGCTTACAAATGCCCGCTGT TGG (reversed) Intronic
905941555 1:41867263-41867285 AGCTTGCCAATGCCTGCTGTAGG - Intronic
906677268 1:47702181-47702203 CACTTACAAGTGCACGCTGTGGG - Intergenic
911437263 1:97877030-97877052 GGCTGACAAATACCAGGTGTGGG + Intronic
911591960 1:99758855-99758877 GGCCTATAAATGGCCGCTCTGGG + Intronic
916191123 1:162179358-162179380 GGCTTTCAAATGCAGGCTGTGGG + Intronic
919566021 1:199189847-199189869 GTCTTACAAAGGCTCTCTGTGGG - Intergenic
1070168795 10:73916898-73916920 GCCTCACAAATGCCCACCGTCGG - Exonic
1074129921 10:110565121-110565143 GGCTTACATATGCCAGCTACTGG - Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1078067292 11:8086776-8086798 TGCTTGCACATGCCCGCTGGTGG + Intronic
1079081611 11:17417082-17417104 GGTTTCCAAATGGCCTCTGTGGG + Intronic
1079763922 11:24365738-24365760 GACTTACAAATGTCCTCTTTAGG + Intergenic
1084475963 11:69389982-69390004 GGCTTGCAATTGGCCACTGTGGG - Intergenic
1101841136 12:108328270-108328292 GGCTAAGAAATGCCGGTTGTAGG - Intronic
1107846972 13:44525026-44525048 GGCTTTGATATACCCGCTGTTGG - Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114417236 14:22552977-22552999 GGCTTACCAATGCCCAGGGTGGG + Intergenic
1117201614 14:53395520-53395542 GGTCTACAAATGGCCGCTCTGGG - Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202864269 14_GL000225v1_random:104948-104970 GTCTCACAAAAGCCCCCTGTGGG + Intergenic
1125492168 15:40156452-40156474 GGCTGACTACTGCCAGCTGTGGG - Intergenic
1128052862 15:64678780-64678802 GGTTTACAAATTCCAGCTGAGGG - Intronic
1132279637 15:100602165-100602187 GGAACACAAATGCCCGCTCTGGG + Exonic
1136361537 16:29783511-29783533 GGTTTACAAATGGCCACTCTGGG + Intergenic
1139495077 16:67310697-67310719 GGCTGACAAATGCGCCCTGATGG + Intronic
1142868192 17:2804033-2804055 GGCAGCCAAATGCCCACTGTTGG + Intronic
1145797683 17:27665508-27665530 GACTCCCAAATGCCCTCTGTAGG + Intergenic
1148342122 17:46879486-46879508 GCTTTACAAATGCCAGGTGTGGG - Intronic
1160834541 19:1118468-1118490 GGCTACCAACTGCCAGCTGTGGG + Intronic
930608707 2:53518119-53518141 GGGTTACAAGTGCCTGCAGTAGG - Intergenic
939260491 2:139801963-139801985 GACTTACAAATGCCCACTCAGGG - Intergenic
939758470 2:146143859-146143881 GGCTTACAAATGTCCTGTGAAGG + Intergenic
941012391 2:160315780-160315802 GGCTTATAAATGCCTTTTGTTGG + Intronic
1170248073 20:14246205-14246227 GTGTTACAAATGGCTGCTGTGGG - Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171798884 20:29590879-29590901 GGCTCAGAAATGCCCTTTGTAGG - Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180891293 22:19291291-19291313 GGCACACAAATTCCCGCTGCAGG - Intronic
1185260845 22:49861994-49862016 TGCTTAGTAATGCCCTCTGTTGG - Intronic
956562815 3:70600605-70600627 GGCATACAAATGTCTGCAGTGGG + Intergenic
956939750 3:74144252-74144274 GGCTTACAAATATCCCCTGCTGG + Intergenic
964193747 3:154037058-154037080 GATTTACAAATGCCCACTGGTGG - Intergenic
972248221 4:37269026-37269048 GGCTTAAAAATCACTGCTGTGGG - Intronic
973031052 4:45340091-45340113 GGCTTATGAATGCCAGCAGTTGG + Intergenic
973969188 4:56194207-56194229 GGCTTACAAATGCCCGCTGTTGG - Intronic
976300871 4:83514379-83514401 AGCTTACAACTGCCTGTTGTGGG - Intronic
979727791 4:123985095-123985117 GGCTATCAAAGCCCCGCTGTGGG - Intergenic
982990079 4:162263031-162263053 GGCTTACAAATATCTCCTGTTGG - Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
999868943 5:155729774-155729796 GGCATCCAAATGCCTCCTGTCGG + Intergenic
1001113653 5:168920526-168920548 GGAATACAGATGCCTGCTGTTGG + Intronic
1003075632 6:2981533-2981555 GGTTTACAAATTCCAGGTGTAGG - Intergenic
1006120054 6:31798637-31798659 GGCTTAGGAATGCCCCCTTTTGG - Intronic
1007583493 6:42973961-42973983 AGGTTACAAATCCCAGCTGTAGG + Intronic
1010520888 6:76835239-76835261 GACTTCCAAATGCTCCCTGTTGG - Intergenic
1013832969 6:114296693-114296715 AGCTCACAAATTCCTGCTGTTGG - Intronic
1014873482 6:126626594-126626616 GGCTTACCAAAGCCAACTGTGGG - Intergenic
1019899605 7:4009893-4009915 GACTTACGAATCCCCGCGGTTGG + Intronic
1035401117 7:158566460-158566482 GGCTGCCAAGTGCCCGCTATGGG - Intronic
1043788211 8:84429164-84429186 GGCTTACAAAAGCATGGTGTTGG + Intronic
1049714803 8:144084825-144084847 GGCCTCTACATGCCCGCTGTCGG + Exonic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1056369681 9:85941418-85941440 GGCTCCCCAGTGCCCGCTGTCGG + Intronic
1203740054 Un_GL000216v2:171068-171090 GTCTCACAAAAGCCCCCTGTGGG - Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1185475593 X:413624-413646 GGCTTGCAAAGGCCCGGGGTGGG + Intergenic
1189890157 X:45592334-45592356 GGCTTACATATTCTCTCTGTGGG + Intergenic
1199652689 X:149962737-149962759 GGCTTACAAATTAACGCTGAGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic
1201179700 Y:11332936-11332958 GGCTCACAAAAGCTCCCTGTGGG - Intergenic