ID: 973971776

View in Genome Browser
Species Human (GRCh38)
Location 4:56220254-56220276
Sequence GACTGAAGTCCTTTGTTTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 195}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973971774_973971776 20 Left 973971774 4:56220211-56220233 CCATAAGCTGAAATACTCCTAAA 0: 1
1: 0
2: 1
3: 39
4: 423
Right 973971776 4:56220254-56220276 GACTGAAGTCCTTTGTTTTCTGG 0: 1
1: 0
2: 0
3: 19
4: 195
973971775_973971776 3 Left 973971775 4:56220228-56220250 CCTAAACACAGAAGAAAAAAAGA 0: 2
1: 3
2: 83
3: 673
4: 4956
Right 973971776 4:56220254-56220276 GACTGAAGTCCTTTGTTTTCTGG 0: 1
1: 0
2: 0
3: 19
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973971776 Original CRISPR GACTGAAGTCCTTTGTTTTC TGG Intronic
900478897 1:2888885-2888907 GACTGAGGTCCCATGTTCTCGGG + Intergenic
903139504 1:21330746-21330768 GACTCAGGTCCTTTCCTTTCTGG + Intronic
905594713 1:39196536-39196558 GACTGAAAACCTTGGGTTTCTGG - Intronic
909005352 1:70269271-70269293 GTCTGCAGTCCTTTTTTTGCAGG - Intronic
910444480 1:87286319-87286341 GACTGAAGTAATATGTTTTGGGG + Intergenic
910783006 1:90962047-90962069 GACTGAAATTCTTTCTTCTCAGG - Intronic
911755632 1:101551298-101551320 GACTGAAGTAGTTTGTTCTGTGG - Intergenic
918049027 1:180958433-180958455 GACTCAATTCCTTTCTGTTCTGG + Intergenic
918076890 1:181177357-181177379 GACAAAAGTGCTTTGTTTTGGGG + Intergenic
919152052 1:193713681-193713703 CACTGAAGTTATTTGTTTTAGGG + Intergenic
919434931 1:197546041-197546063 TACTGTAATACTTTGTTTTCAGG - Intronic
924704129 1:246485129-246485151 GGTTGAAGTCATGTGTTTTCAGG - Intronic
1063224169 10:3999310-3999332 TACTGAAGTATTTTTTTTTCTGG + Intergenic
1067011586 10:42719199-42719221 GCCAGAAAACCTTTGTTTTCTGG + Intergenic
1067432970 10:46256086-46256108 GACTGAAGTGCTATTTATTCAGG - Intergenic
1067517775 10:46968217-46968239 GAGTCAGGTCCTCTGTTTTCTGG + Intronic
1067644473 10:48083612-48083634 GAGTCAGGTCCTCTGTTTTCTGG - Intergenic
1067981676 10:51093521-51093543 GTCTGAAATGCTTTGTTTTATGG + Intronic
1068185443 10:53579813-53579835 GACTGTAGTTTTTGGTTTTCAGG + Intergenic
1069130331 10:64692977-64692999 GAGTGAATTCATTTTTTTTCAGG + Intergenic
1070567386 10:77614159-77614181 CACTGAATCTCTTTGTTTTCTGG - Intronic
1071026564 10:81121273-81121295 GATTCAAGTCTTTTATTTTCTGG + Intergenic
1074423670 10:113331770-113331792 AACCGAAGTCCTTTGATCTCTGG + Intergenic
1076539397 10:131204630-131204652 GACAGATGTCCTTTGATTTGAGG - Intronic
1077510480 11:2958296-2958318 GACTTTAGTCCTCTTTTTTCAGG - Intronic
1079329179 11:19520069-19520091 CACTGAGGTCCTTTCTTTGCTGG + Intronic
1079778570 11:24566665-24566687 GCCTGAGATCCTGTGTTTTCAGG + Intronic
1081866591 11:46363673-46363695 GACTGTGGCCTTTTGTTTTCTGG + Intronic
1084839847 11:71837557-71837579 GACTGAAGCCTGTTGTTTTCTGG + Exonic
1087977557 11:104568419-104568441 GACTTAATTCTTTTGGTTTCAGG + Intergenic
1088483614 11:110320150-110320172 GACTGAGCTCCTTGGATTTCTGG + Intergenic
1089097391 11:115930734-115930756 GAATGGAGTACTTTGGTTTCTGG - Intergenic
1089712055 11:120322564-120322586 GGCTGAGGCCCTTTGTTTTGGGG - Intergenic
1093105907 12:15086806-15086828 GAATTAAGTCCTTTGTATTGAGG - Intergenic
1093178286 12:15937967-15937989 GTCTGAATCCCTTTGTTTTGAGG + Intronic
1095075923 12:37924904-37924926 GACTGAAGTCCTTTTTTTGATGG - Intergenic
1095938537 12:47710739-47710761 GACTGAAGTGCTATCTTCTCTGG - Exonic
1096038653 12:48494891-48494913 GACTGAAGAGCTGTGTCTTCAGG - Exonic
1096885274 12:54712577-54712599 GAATGATGTCCTTTTTTTCCTGG + Intergenic
1099438653 12:82673378-82673400 GACTGAAGGCCTTTTCTCTCTGG + Intergenic
1101307361 12:103542513-103542535 GACTGAAACCCTTTGTGATCTGG + Intergenic
1101778792 12:107817307-107817329 GCCTGAAGCCCTTTCTTTACTGG - Intergenic
1102273142 12:111557357-111557379 AATTCAAGTCCATTGTTTTCTGG - Intronic
1104315237 12:127692754-127692776 GACTGATGTTATTTGTTTACGGG - Intergenic
1104415980 12:128596896-128596918 GACTGAAGACCACTGTCTTCCGG + Intronic
1105532650 13:21233840-21233862 TACTGAAATACTTTGCTTTCTGG + Intergenic
1106973483 13:35175306-35175328 GACTGACATGCTTTGATTTCTGG + Intronic
1107316453 13:39137497-39137519 AGCTGATGTCTTTTGTTTTCTGG + Intergenic
1107357223 13:39580787-39580809 GCCTCAGGTCCTTTGTTTACAGG - Intronic
1111890044 13:94070007-94070029 TACTGTATTACTTTGTTTTCAGG + Intronic
1112281031 13:98063463-98063485 GACTGAAATCTCTTGTTTTCAGG + Intergenic
1114879849 14:26770774-26770796 GTCTGAAGTCCATTAGTTTCAGG + Intergenic
1119158380 14:72432195-72432217 GACAGGAGTCCTTTGTCCTCTGG + Intronic
1120903730 14:89600622-89600644 GACTGAATTATTTGGTTTTCAGG + Intronic
1123725702 15:23099371-23099393 GTCTTAAGACCTTTGTATTCTGG + Intergenic
1124546674 15:30634670-30634692 CACTGAAAGCCTTTGTTTACTGG + Intronic
1124780279 15:32624670-32624692 CACTGAAAGCCTTTGTTTACTGG + Intronic
1125282206 15:38054639-38054661 GACAGAATTCCCTTGATTTCAGG - Intergenic
1125898062 15:43319273-43319295 GACTGAAGTTCCTTGTTAGCAGG - Intergenic
1134169577 16:11957692-11957714 GGCTGAATTCCTTCTTTTTCAGG - Intronic
1135769058 16:25202381-25202403 GACTGAATAACTTTGTTTTGGGG - Intergenic
1135936500 16:26784998-26785020 TACTGATGTCCTTTGATTCCTGG - Intergenic
1136271324 16:29150255-29150277 GTCTGCAGTCCTGTGTTTACTGG - Intergenic
1137315783 16:47320828-47320850 GACAGAAGTACTTTTTCTTCAGG + Intronic
1138637021 16:58348105-58348127 GACTGGAATCCCATGTTTTCAGG + Intronic
1139241848 16:65401266-65401288 GACTAAAATCTGTTGTTTTCGGG + Intergenic
1142074937 16:88112235-88112257 GTCTGCAGTCCTGTGTTTACTGG - Intronic
1144564538 17:16349154-16349176 AACTGAAGTCCCCTCTTTTCAGG + Intronic
1149026872 17:52036935-52036957 GACTAGAGTCCTTCATTTTCTGG - Intronic
1151249112 17:72820072-72820094 CACAGAAGTCACTTGTTTTCTGG - Intronic
1152320283 17:79605052-79605074 GACTGCAGTCCATGGTGTTCGGG + Intergenic
1155501502 18:26491498-26491520 TTCTGAAGTCCTTTTCTTTCAGG - Intronic
1156944407 18:42811386-42811408 TAGTGTAGTCCTTTGTTTTCTGG - Intronic
1157029300 18:43885872-43885894 GCCTGTAGTCCTAGGTTTTCAGG - Intergenic
1157918607 18:51693907-51693929 GACTGGAGTCCTTGGCTTCCAGG - Intergenic
1157992390 18:52512441-52512463 CACTGAAGTTCTTTCTTTGCTGG + Intronic
1164622646 19:29706371-29706393 GAGAAAATTCCTTTGTTTTCAGG + Intronic
1165097000 19:33414857-33414879 TCCTGAAATCCTTTCTTTTCAGG - Intronic
1165191785 19:34069759-34069781 GTCTGAAGTCCTGTGTTGTTTGG - Intergenic
1165675152 19:37716346-37716368 GACTGGAGTCTCCTGTTTTCAGG + Intronic
1165683211 19:37795546-37795568 GACTGGAATCTCTTGTTTTCAGG - Intronic
1167776578 19:51562143-51562165 GAATGAAGTTCTTTATTTACTGG + Intergenic
925572676 2:5328851-5328873 GAGTGAAGTTATTTGCTTTCTGG + Intergenic
928012245 2:27620629-27620651 GATTGAAGTTCTTTCTTTTTTGG + Intronic
929210213 2:39348554-39348576 GACTGAAGTCCTTTCCTATTAGG - Intronic
930953387 2:57172931-57172953 TACTGAAGTCCTTTTGTTTTGGG - Intergenic
931111298 2:59114186-59114208 GACTGAAGTCCAGTCTTCTCTGG + Intergenic
933634734 2:84695229-84695251 GTTTAAAGCCCTTTGTTTTCTGG - Intronic
933818809 2:86091066-86091088 GAGTATAGTCCTTTGTGTTCCGG - Intronic
934101670 2:88659329-88659351 TACTGAACTCCTTTTTTTCCTGG - Intergenic
935340518 2:102055716-102055738 AACTGAAGTCCAATGTTTTCTGG - Intergenic
936982970 2:118280592-118280614 GTCTGAAATCCTTGGCTTTCAGG - Intergenic
937343108 2:121104590-121104612 GACTGAACTCCTCTGTCTTTGGG - Intergenic
938770306 2:134495772-134495794 GACTGGAATCTTCTGTTTTCAGG - Intronic
939176450 2:138753519-138753541 TACTGGAGTGTTTTGTTTTCAGG + Intronic
940173947 2:150858420-150858442 GACTGAGGCCATTTGTTTTTCGG + Intergenic
940754762 2:157669526-157669548 GTCTGAAGGCCTTGGTCTTCTGG + Intergenic
941395175 2:164965031-164965053 GACTTAAGTCTTTTTCTTTCTGG + Intergenic
942898094 2:181082591-181082613 GACTGAAGTCATTTCTATTAAGG - Intergenic
943908992 2:193539213-193539235 GACAGAAGTGCCTTTTTTTCAGG - Intergenic
944085604 2:195844417-195844439 GGCTGAAGTCCTTGGTTTCTGGG + Intronic
945139579 2:206669953-206669975 GAGGGAAGACCTTTGTTTTCAGG - Intronic
945517324 2:210778611-210778633 GACTGAAGTTGTTTCTTATCTGG + Intergenic
945599946 2:211848438-211848460 GACACAAGTCCATTGCTTTCTGG + Intronic
946593408 2:221277386-221277408 GAATGAAGACCATTTTTTTCAGG - Intergenic
947545375 2:231006843-231006865 GAAAGAAGTCCTTTGCTTTTAGG - Intronic
947567518 2:231204013-231204035 GCCCCAAGTCTTTTGTTTTCTGG - Intronic
947836187 2:233177415-233177437 GACTGAAGCCCTTAGATTTTAGG - Intronic
948003841 2:234591271-234591293 GACTTTAGTTCTTTGTTTCCAGG + Intergenic
1169333341 20:4733663-4733685 GAGTGAAGTCATTTATTTTAGGG + Intronic
1171416236 20:24982573-24982595 GATTGAAGACCTTTGATCTCAGG - Intronic
1172328941 20:34060628-34060650 GAGTGAAGGCATTTGGTTTCAGG + Intronic
1174044076 20:47720960-47720982 GACTGAAGTCTTTGTTTTTTTGG + Intronic
1178163247 21:29942731-29942753 GACTGAAATATTTTGTTTTTTGG + Intergenic
1178907045 21:36645222-36645244 GACAGAATTCCTTTTTTTTTAGG - Intergenic
1183298041 22:37043658-37043680 GCCTGGCGTCCTTTGTTCTCTGG - Intergenic
1183825261 22:40381554-40381576 AACTGGAGTCCTTTAGTTTCTGG + Intronic
1184786799 22:46675997-46676019 GCCTGTGGTCCCTTGTTTTCTGG + Intronic
949624604 3:5852271-5852293 AACTGAAATTCTTTGTTTTAAGG + Intergenic
952446780 3:33388851-33388873 CACTGAAGTAGTTTGTCTTCTGG + Exonic
954273791 3:49529462-49529484 CACTCAAGTACTTTGTTTTTTGG + Intronic
956069038 3:65428386-65428408 GTGTGACGTCCTGTGTTTTCTGG + Intronic
956695837 3:71918735-71918757 GACTGAAGCCTTTTGTTCACTGG + Intergenic
956827076 3:73007292-73007314 GTTTGAAGTTCTTTGTGTTCAGG + Intronic
960406027 3:117261211-117261233 GAGTGGATTCCTTTGTTTTCAGG + Intergenic
962033339 3:131624423-131624445 AAATAAAGTCCTGTGTTTTCTGG - Intronic
964659265 3:159101702-159101724 GACTGATCTTCTTTGTGTTCAGG + Intronic
964980970 3:162678463-162678485 CACTGATTTGCTTTGTTTTCTGG - Intergenic
966430478 3:179827049-179827071 GAATGAAGTATTTTGATTTCTGG - Intronic
966778446 3:183563076-183563098 GTCTGCAGTCCTTGGTTCTCTGG - Intergenic
967580305 3:191145377-191145399 GACTGAGTTCCTTTCCTTTCAGG - Intergenic
968541303 4:1169704-1169726 GTCTGAAGTCCGCTGTTGTCTGG + Intronic
969780931 4:9403560-9403582 GACTGAAGCCTCTTGTTTTCTGG + Intergenic
971236704 4:24848989-24849011 GACAGCAGTCCTTTCTTATCTGG - Intronic
971860015 4:32090187-32090209 GTCTGAGGTCCTATATTTTCAGG - Intergenic
972285438 4:37643737-37643759 GACTGAAATCCTCTATTTTGTGG - Intronic
972815818 4:42644152-42644174 GACTGAAGGCCTTCGTATTAAGG + Intronic
973268468 4:48235174-48235196 GACTGTAATCTTCTGTTTTCAGG + Intronic
973971776 4:56220254-56220276 GACTGAAGTCCTTTGTTTTCTGG + Intronic
974140370 4:57878952-57878974 GACTGAAGAAGTTTTTTTTCAGG - Intergenic
974323126 4:60378202-60378224 CACTGCAGCCCTTTGTTTTATGG + Intergenic
974770448 4:66404765-66404787 GACTGACATAATTTGTTTTCTGG + Intergenic
975369273 4:73566286-73566308 GATTAATATCCTTTGTTTTCTGG + Intergenic
977156496 4:93580428-93580450 GAAAGAACTCCTGTGTTTTCAGG + Intronic
977251482 4:94693822-94693844 GACAGAATTCCTTTCTCTTCAGG - Intergenic
977426591 4:96874414-96874436 GTCTGAATACCTTTGTTTTTTGG - Intergenic
978444017 4:108763321-108763343 TAGTGTAGTCCTTTATTTTCTGG + Intergenic
978473394 4:109097103-109097125 GACTGAAATCCCCTGTTTGCAGG + Intronic
982349202 4:154396360-154396382 AACTGAAGGCCTCTCTTTTCTGG - Intronic
983680870 4:170352023-170352045 CACTGAAGTTCTTTTTATTCAGG + Intergenic
984568467 4:181360518-181360540 GCCTGAAATCCTTTCTTTTCAGG - Intergenic
986111948 5:4728144-4728166 GACACAAGTCCTTGGGTTTCGGG - Intergenic
987789093 5:22541043-22541065 AACAGAAGTCATTTGTTTCCTGG + Intronic
988285536 5:29211441-29211463 AACTGAAGTCTCCTGTTTTCAGG - Intergenic
989450195 5:41577760-41577782 AACTGAGGTCTGTTGTTTTCAGG + Intergenic
989854915 5:46272063-46272085 GAGGTAAGTCCTTTTTTTTCTGG - Intergenic
990661717 5:58022748-58022770 GACTCTAATCCTTTGTTTTTTGG - Intergenic
992019276 5:72606309-72606331 GACAGCATTCCTTTGTCTTCTGG + Intergenic
1001078321 5:168646807-168646829 AACTGAAATCCTTTGTGATCTGG + Intergenic
1003097137 6:3151232-3151254 CACTCAAGGCCTTTGTTTTCAGG - Intronic
1004253241 6:14040024-14040046 GATTGACATCCTTTGTTTTTTGG + Intergenic
1005960038 6:30687659-30687681 CTCTGAAGTCCTTTGTTTTGCGG + Exonic
1007589771 6:43014038-43014060 TAATGCAGTCCTTTGTTTTTTGG - Intergenic
1008442106 6:51543603-51543625 GATCCAAGTCCTTTGTTTTGAGG - Intergenic
1009756454 6:67946668-67946690 GACTGTAGTCCTTGCTTCTCAGG - Intergenic
1010832974 6:80553547-80553569 GAAAGATGGCCTTTGTTTTCTGG - Intergenic
1011672886 6:89700962-89700984 TAAACAAGTCCTTTGTTTTCTGG - Intronic
1012032753 6:94093494-94093516 GTCTAATGTCATTTGTTTTCTGG - Intergenic
1013322294 6:109006129-109006151 GACTCATGTTCTTTGTTTACAGG - Intronic
1013921144 6:115405288-115405310 GACTGGAATCTTCTGTTTTCAGG - Intergenic
1015018127 6:128438701-128438723 GCCTGAACTCCTTTGTCTTTAGG - Intronic
1018840763 6:167514524-167514546 GTCCCAAGTCCTTTCTTTTCAGG + Intergenic
1019613791 7:1949707-1949729 GACCGATGTCCTTTGGTTCCTGG - Intronic
1019898647 7:4002320-4002342 GGCTGAAATTCTTTGTTGTCTGG + Intronic
1022771318 7:33475856-33475878 CAGTGAAGTCTTTTGTTCTCAGG - Intronic
1023325362 7:39049767-39049789 TACTGAGGTCCTTTATTTTTTGG + Intronic
1024441088 7:49418435-49418457 TACAGCAGTCCTTTGCTTTCAGG - Intergenic
1028352453 7:89865505-89865527 GAGTGAGGTCCTTTGTAATCTGG - Intergenic
1029088465 7:98029906-98029928 GACTGATTTCCTTTCTTTTGGGG + Intergenic
1033213539 7:139478239-139478261 GACTGTAGTCCTTGCTATTCAGG + Intronic
1035283116 7:157789543-157789565 GGCTGAATTCCCTTGTTGTCAGG - Intronic
1036079221 8:5535325-5535347 GACTGGAGTCATAGGTTTTCAGG + Intergenic
1036278368 8:7377495-7377517 GACTGAAGCCTGTTGTTTTCTGG + Intronic
1036343155 8:7934395-7934417 GACTGAAGCCTGTTGTTTTCTGG - Intronic
1036713275 8:11096898-11096920 GAATGAAGACATTTGGTTTCAGG + Intronic
1036838490 8:12095159-12095181 GACTGAAGCCTGTTGTTTTCTGG - Intergenic
1036860281 8:12341407-12341429 GACTGAAGCCTGTTGTTTTCTGG - Intergenic
1036978866 8:13446171-13446193 GTCAAAAGTTCTTTGTTTTCTGG - Intronic
1041553253 8:59123579-59123601 TTCTGAAATCCTTTATTTTCTGG - Intergenic
1044288607 8:90440521-90440543 GAATAATGTCATTTGTTTTCAGG + Intergenic
1045046309 8:98282226-98282248 TACTGCAGTCCTCTGCTTTCAGG - Intronic
1045871388 8:106931426-106931448 TTCTGAAGTACTTTGTTTTGAGG + Intergenic
1046366785 8:113243377-113243399 GATTGTAGTCTTCTGTTTTCAGG + Intronic
1048081455 8:131132533-131132555 GAATGCAGTCTTTTGTTCTCAGG - Intergenic
1050857316 9:10376194-10376216 GAATGAAGTCATTTCTTATCAGG + Intronic
1052194446 9:25694357-25694379 GACTGGAGTCTTCTGTTTTCAGG - Intergenic
1053043641 9:34895381-34895403 GGCTGAACTCCTTTGACTTCTGG - Intergenic
1053311434 9:37023314-37023336 GACAGAGGACCTTTGTTTTCTGG + Intronic
1056405710 9:86272508-86272530 GACTGCAGTCTTTTGCTTTCTGG - Intronic
1056568308 9:87794169-87794191 GAATGCTGTCCTGTGTTTTCTGG - Intergenic
1057094113 9:92289332-92289354 GACTGAATTTAATTGTTTTCAGG - Exonic
1058213618 9:102204150-102204172 GATTAGAGTCCTCTGTTTTCAGG - Intergenic
1058393036 9:104519293-104519315 GGCAGAATTCCTTTCTTTTCTGG + Intergenic
1059976520 9:119723835-119723857 GGCTGAAGTCATGTGTTCTCAGG + Intergenic
1060840511 9:126789646-126789668 GACCGTAGTCCTTTTGTTTCAGG + Intergenic
1061632315 9:131880381-131880403 CATTGAAGTCCTTTTTTTTCAGG - Intronic
1061950841 9:133935062-133935084 GACTGCAGAGCTTTGTGTTCTGG + Intronic
1186147159 X:6636159-6636181 GACTGATTTTCTTTGTTTCCAGG - Intergenic
1186931760 X:14399437-14399459 GAATGAAGTGTTTTCTTTTCAGG + Intergenic
1188509376 X:30918641-30918663 CACTGTCTTCCTTTGTTTTCTGG + Intronic
1192014948 X:67319332-67319354 GAATGAAGTAGTTTGTTGTCAGG - Intergenic
1193236919 X:79117757-79117779 TACTGAGGTCCTTTTATTTCTGG - Intergenic
1194961348 X:100239699-100239721 CACTGAACTACTGTGTTTTCTGG + Intergenic
1196977283 X:121174025-121174047 GACTTAAATACTTGGTTTTCTGG + Intergenic
1198919471 X:141709192-141709214 TACTGTATTCATTTGTTTTCAGG + Intergenic