ID: 973973594

View in Genome Browser
Species Human (GRCh38)
Location 4:56240272-56240294
Sequence CCTAACCTCCACATGCTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 232}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973973594_973973604 7 Left 973973594 4:56240272-56240294 CCCTGTAGCATGTGGAGGTTAGG 0: 1
1: 0
2: 2
3: 27
4: 232
Right 973973604 4:56240302-56240324 ATTCCTAACACAGACTGGGGAGG 0: 1
1: 0
2: 1
3: 11
4: 144
973973594_973973606 9 Left 973973594 4:56240272-56240294 CCCTGTAGCATGTGGAGGTTAGG 0: 1
1: 0
2: 2
3: 27
4: 232
Right 973973606 4:56240304-56240326 TCCTAACACAGACTGGGGAGGGG No data
973973594_973973601 2 Left 973973594 4:56240272-56240294 CCCTGTAGCATGTGGAGGTTAGG 0: 1
1: 0
2: 2
3: 27
4: 232
Right 973973601 4:56240297-56240319 GGGGGATTCCTAACACAGACTGG 0: 1
1: 0
2: 0
3: 6
4: 87
973973594_973973602 3 Left 973973594 4:56240272-56240294 CCCTGTAGCATGTGGAGGTTAGG 0: 1
1: 0
2: 2
3: 27
4: 232
Right 973973602 4:56240298-56240320 GGGGATTCCTAACACAGACTGGG 0: 1
1: 0
2: 0
3: 5
4: 104
973973594_973973610 17 Left 973973594 4:56240272-56240294 CCCTGTAGCATGTGGAGGTTAGG 0: 1
1: 0
2: 2
3: 27
4: 232
Right 973973610 4:56240312-56240334 CAGACTGGGGAGGGGGAGTAGGG 0: 1
1: 0
2: 12
3: 88
4: 726
973973594_973973603 4 Left 973973594 4:56240272-56240294 CCCTGTAGCATGTGGAGGTTAGG 0: 1
1: 0
2: 2
3: 27
4: 232
Right 973973603 4:56240299-56240321 GGGATTCCTAACACAGACTGGGG 0: 1
1: 0
2: 0
3: 12
4: 137
973973594_973973609 16 Left 973973594 4:56240272-56240294 CCCTGTAGCATGTGGAGGTTAGG 0: 1
1: 0
2: 2
3: 27
4: 232
Right 973973609 4:56240311-56240333 ACAGACTGGGGAGGGGGAGTAGG 0: 1
1: 0
2: 9
3: 129
4: 854
973973594_973973608 10 Left 973973594 4:56240272-56240294 CCCTGTAGCATGTGGAGGTTAGG 0: 1
1: 0
2: 2
3: 27
4: 232
Right 973973608 4:56240305-56240327 CCTAACACAGACTGGGGAGGGGG 0: 1
1: 0
2: 0
3: 23
4: 315
973973594_973973605 8 Left 973973594 4:56240272-56240294 CCCTGTAGCATGTGGAGGTTAGG 0: 1
1: 0
2: 2
3: 27
4: 232
Right 973973605 4:56240303-56240325 TTCCTAACACAGACTGGGGAGGG 0: 1
1: 0
2: 3
3: 10
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973973594 Original CRISPR CCTAACCTCCACATGCTACA GGG (reversed) Intronic
900139303 1:1132827-1132849 CCTAACCTCCTCCTGCAACTAGG + Intergenic
900722113 1:4183596-4183618 CCTGTCCTCGAGATGCTACAAGG - Intergenic
900841206 1:5050016-5050038 CCTGTCCTCGAGATGCTACAGGG + Intergenic
902836704 1:19052021-19052043 CCTAACCCCCACATCATTCAAGG + Intergenic
903011687 1:20335472-20335494 CCTAACCTCCACATTGTTCAAGG - Intronic
905429605 1:37911961-37911983 CCTGTCCTCGAGATGCTACAGGG + Intronic
909169028 1:72270449-72270471 CATAACCTACAGATGCTCCAAGG + Intronic
909729913 1:78877834-78877856 CCTGTCCTCGAGATGCTACAGGG + Intergenic
911071606 1:93836148-93836170 CCTGTCCTCGAGATGCTACAGGG + Intronic
911930516 1:103897001-103897023 CCTAACTTCCACATTGTTCAAGG + Intergenic
914470514 1:147973547-147973569 CCTAACATCCAGAATCTACAAGG - Intronic
914698291 1:150106348-150106370 ACTACCATCCACATCCTACAAGG + Intronic
915900773 1:159845241-159845263 CCTCACCTCCACAATCTATATGG + Intronic
916275264 1:162987198-162987220 CCAAACATCTAAATGCTACAGGG - Intergenic
916942065 1:169686781-169686803 CCTGTCCTCGAAATGCTACAAGG + Intronic
917734521 1:177908317-177908339 CCTACCATCCTCAGGCTACACGG + Intergenic
919476811 1:198039897-198039919 CCTGTCCTCCGAATGCTACAGGG + Intergenic
919709772 1:200714432-200714454 CCTGACATCCACATCCTCCAGGG - Intergenic
920436349 1:205949512-205949534 CCTCACCTCCACATGCTCCCTGG + Intergenic
922146438 1:222950134-222950156 CCTAACCTCAATAACCTACAGGG - Intronic
922877412 1:228950812-228950834 CCTGTCCTCAAAATGCTACAAGG + Intergenic
1062888681 10:1038948-1038970 CCTGCCCTCCACCTGCTCCATGG - Intergenic
1063879612 10:10517643-10517665 CCTACCCTTCCCATGCTGCAGGG - Intergenic
1066129713 10:32380990-32381012 CCTAACCCCCACATACTTCAAGG - Intergenic
1066624016 10:37387635-37387657 CATAACCTTCATATGCTACATGG - Intergenic
1067082904 10:43221637-43221659 CCTAACCTGCAAATGCAGCAGGG - Intronic
1070838612 10:79467823-79467845 CCCAACCTCCTCAGGCTCCAGGG + Intergenic
1070981196 10:80649593-80649615 GCTAGCCTCCTCATTCTACAGGG - Intergenic
1071010566 10:80935660-80935682 CCTAACCTCCACATTGTTCAAGG + Intergenic
1071489412 10:86126030-86126052 CCTAATCTCCACATTGTTCAAGG + Intronic
1071666596 10:87564402-87564424 ACCAACCTGCACATGCTACCTGG + Intergenic
1072449977 10:95532144-95532166 CCCAACCCCCACAACCTACAAGG + Intronic
1073130491 10:101185768-101185790 CCTGTCCTCCAGATGCTACAGGG - Intergenic
1073219087 10:101854638-101854660 CCTTACCTCCAGAGGCTTCAGGG - Intronic
1073798390 10:107013764-107013786 TCTGACCTCCTCATGCTACAAGG + Intronic
1074914038 10:117938655-117938677 CCTAATCTCCACTTTTTACAAGG + Intergenic
1075014363 10:118899385-118899407 CCTGTCCTCAAGATGCTACAGGG + Intergenic
1075701986 10:124475829-124475851 CCTCACCCCCACATGCCACGAGG + Intronic
1075741472 10:124698877-124698899 CCTCTCCTCCACAGCCTACAGGG + Intronic
1077982524 11:7315030-7315052 CCTTCTCTCCACATGCCACAGGG + Intronic
1078378682 11:10819481-10819503 CCTAACCTCCACATTGTTCAAGG + Intronic
1079419758 11:20275212-20275234 TCTATTCTCCACATTCTACATGG + Intergenic
1079807149 11:24946994-24947016 CCTAACTTCCACATTGTTCAAGG - Intronic
1083818758 11:65153755-65153777 CCTCCCCTCCACATGTCACAAGG - Intergenic
1084354652 11:68629743-68629765 CCTGTCCTCAAGATGCTACAAGG + Intergenic
1085556453 11:77427068-77427090 AGAAACCCCCACATGCTACAAGG + Intronic
1086339228 11:85830463-85830485 CATAAACACCACATGCTGCATGG - Intergenic
1086587325 11:88469449-88469471 CCTAACCCCCACATTGTTCAAGG - Intergenic
1087167629 11:95020940-95020962 CCTGTCCTCAAGATGCTACAGGG - Intergenic
1087197335 11:95314675-95314697 CCTGTCCTCGAGATGCTACAGGG + Intergenic
1087513661 11:99129653-99129675 CATAACCTTCACATTCTCCAAGG + Intronic
1088297886 11:108320723-108320745 CCTAACCTCCAAGTGGTTCAAGG - Intronic
1088543994 11:110941615-110941637 CCTAACCCCCACATTGTTCAAGG - Intergenic
1089953789 11:122552495-122552517 CCTGTCCTCGAGATGCTACACGG + Intergenic
1090847005 11:130538046-130538068 CCTAACATCCAGAGTCTACAAGG - Intergenic
1091886781 12:4022549-4022571 CCTATCCTCAGAATGCTACAGGG + Intergenic
1092981842 12:13803303-13803325 CCTAACCCCCACATTGTTCAAGG + Intronic
1093682605 12:22020108-22020130 CCTAACCCCCACATTGTGCAAGG + Intergenic
1094782843 12:33812823-33812845 ACAAACCTGCACATCCTACACGG - Intergenic
1094826209 12:34271100-34271122 CCTGTCCTCGAGATGCTACAGGG + Intergenic
1095306523 12:40645118-40645140 GCCAACCTCCACATTCAACAAGG + Intergenic
1095520808 12:43063185-43063207 TCTAACCATCAAATGCTACAAGG + Intergenic
1096009485 12:48201060-48201082 CCTTACCTCCTCATCTTACATGG - Intergenic
1098707385 12:73707838-73707860 TCTAACATCCACAGTCTACAAGG + Intergenic
1099999416 12:89815059-89815081 CCTAACCCCCACATTTTTCAAGG + Intergenic
1102604975 12:114061364-114061386 CCTGTCCTCAAGATGCTACAGGG + Intergenic
1104364097 12:128161456-128161478 CCTAACCTGCCCAAGATACATGG - Intergenic
1104492135 12:129203491-129203513 CCTGCCCTCCACATGCTTCCTGG - Intronic
1107395148 13:40007612-40007634 CATAACCTCCACATTTTTCAAGG + Intergenic
1109276002 13:60305237-60305259 CCTAACCTCCATGTTCTTCAAGG - Intergenic
1113672368 13:112183735-112183757 CCTAACCTCCTCTTCCTATAAGG + Intergenic
1113693838 13:112330368-112330390 CCCACCCTCCACATGCCACGAGG + Intergenic
1118699235 14:68416870-68416892 CCTACCCTCCTCATGCTATCTGG - Intronic
1118936858 14:70296516-70296538 CCTGTCCTCGAGATGCTACAAGG - Intergenic
1119873944 14:78040800-78040822 CCTATCCCCCACATGGTACCAGG + Intergenic
1120578352 14:86212930-86212952 CAAAACCTCAACATGCTACAGGG - Intergenic
1120907950 14:89636780-89636802 CCTAACCTCCGCATTCTTCAAGG + Intronic
1120989740 14:90364641-90364663 ACCAACCTCCAGATCCTACAAGG + Intergenic
1121905002 14:97731672-97731694 CCTAACCTCCACATTGTTTAAGG - Intergenic
1122041344 14:98989806-98989828 CCTGTCCTCGAGATGCTACAGGG + Intergenic
1123454341 15:20405811-20405833 CCTAACCTTCACATTGTTCAAGG + Intergenic
1124167797 15:27343489-27343511 CCTAACCTCCAAAATCAACAAGG - Intronic
1126027427 15:44461217-44461239 CCTAAACTCCACATTGTTCAAGG - Intronic
1126561034 15:50044132-50044154 CCTAACCCCCACATCATTCAAGG + Intronic
1127707309 15:61560015-61560037 CCTAACCCCCACATTGTTCACGG - Intergenic
1127709461 15:61581310-61581332 CTCAACCTCCACATTGTACAGGG + Intergenic
1129577326 15:76764290-76764312 CCTCAGCTCCAAAAGCTACAGGG + Intronic
1132476726 16:142974-142996 GCCAACCTCCATTTGCTACAGGG + Intergenic
1134179706 16:12037572-12037594 CCTAACCTCCCCCTACTGCAGGG - Intronic
1135023958 16:18984853-18984875 CGTAAGCTCCAAATGCTACAAGG - Intronic
1135306451 16:21371342-21371364 CCTAACCTCCCCCTACTGCAGGG - Intergenic
1136303194 16:29350485-29350507 CCTAACCTCCCCCTACTGCAGGG - Intergenic
1138758655 16:59518052-59518074 CCTGTCCTCGAGATGCTACAGGG - Intergenic
1139038894 16:62980247-62980269 CCTGTCCTCGGCATGCTACAAGG - Intergenic
1140878099 16:79172098-79172120 CCTGGCCTCCACCTGCTACATGG - Intronic
1143746207 17:8996029-8996051 ATTCACCTCCACCTGCTACAGGG - Intergenic
1144119584 17:12138216-12138238 CCTAACCTCCACACCATTCAAGG - Intronic
1144501375 17:15788536-15788558 CCTAACCACCACATGCGACATGG + Intergenic
1144718166 17:17448900-17448922 ACTGACCTCCACATGCTGCAGGG + Intergenic
1144774000 17:17775142-17775164 CCTAACCCCCACATTGTTCAAGG - Intronic
1145163550 17:20591210-20591232 CCTAACCACCACATGCGACATGG + Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148648942 17:49235780-49235802 CCTGACCACCACTTGCCACACGG - Intergenic
1149819818 17:59765414-59765436 CCTAACCCACACATGGTTCAAGG - Intronic
1149926581 17:60707457-60707479 CCTACCCTCCACATTGTTCAAGG + Intronic
1151547593 17:74802550-74802572 CCCAACCTGCACATTCTACCAGG - Intronic
1152591750 17:81216996-81217018 CCTAAACTCCACCTGCAAGAAGG + Intronic
1152910115 17:82999422-82999444 CCTAACCCCCACATTGTTCAGGG - Intronic
1156009884 18:32484590-32484612 CCTAACCTCCACATTGTTCAAGG - Intergenic
1156382900 18:36580162-36580184 CCCAGCCTCCCCATCCTACACGG + Intronic
1156389861 18:36640154-36640176 CCTAAACTTTGCATGCTACAGGG + Intronic
1156916247 18:42466782-42466804 CCTGTCCTCAAGATGCTACAGGG + Intergenic
1156923689 18:42553461-42553483 CCTATCCTCGAGATGCTACAGGG - Intergenic
1157928674 18:51794658-51794680 TCTAACCTCCACATTGTTCAAGG + Intergenic
1158394301 18:57067730-57067752 CCTGTCCTCGAGATGCTACAGGG - Intergenic
1158877499 18:61747339-61747361 CCTAACCTCTACATTGTTCAAGG + Intergenic
1161602838 19:5195337-5195359 CCTACCCTCAACAAGCCACAAGG - Intronic
1162273705 19:9636726-9636748 CCTATCCTCAAGAAGCTACAGGG - Intronic
1163899731 19:20090790-20090812 CCTGTCCTCGAGATGCTACAGGG - Intronic
1166397184 19:42450026-42450048 CCTGTCCTCGAGATGCTACAGGG - Intergenic
1166751472 19:45165764-45165786 CCTACCCTCCAGACACTACATGG - Intronic
1166814040 19:45531170-45531192 CATAACCTCCATATTTTACATGG - Intronic
1166905310 19:46104235-46104257 CCTGTCCTCGAGATGCTACAGGG - Intergenic
1167375653 19:49109808-49109830 CCTGACTTCCTCATGCTAAATGG - Intergenic
927352958 2:22140181-22140203 CCTAACTTGCACATCCCACATGG - Intergenic
928872799 2:36000651-36000673 GCAAACCTGCACAGGCTACATGG + Intergenic
928928911 2:36603645-36603667 CCTGTCCTCAAAATGCTACAGGG + Intronic
929845662 2:45522964-45522986 CCCAACCTCCACATTGTTCAAGG + Intronic
929988195 2:46758868-46758890 CCTACTCTCGACATGCTCCATGG + Exonic
930260093 2:49135619-49135641 CCTAACCTCCACATTGTTCAAGG - Intronic
934141061 2:89047947-89047969 CCCAACCTCCACATTGTTCAGGG - Intergenic
934141770 2:89053876-89053898 CCTGACTTCAAGATGCTACAGGG + Intergenic
934220818 2:90080978-90081000 CCCAACCTCCACATTGTTCAGGG + Intergenic
934228173 2:90152595-90152617 CCCAACCTCCACATTGTTCAGGG + Intergenic
937617137 2:123938729-123938751 CTTAACCTCCACATTATTCAAGG + Intergenic
938703456 2:133899494-133899516 CCCAGCCTCCCCATGCTCCAAGG + Intergenic
943412511 2:187561025-187561047 CCTGTCCTCGAGATGCTACAGGG - Intronic
943829943 2:192447917-192447939 GCTAACCTCTACATAATACAGGG - Intergenic
945146132 2:206740137-206740159 CGTAACCTCCACATTGTTCAGGG - Intronic
945481052 2:210346165-210346187 CCTAATCTCCAGAATCTACAAGG - Intergenic
947894736 2:233659228-233659250 CCTAATCTCCACATTGTTCAAGG - Intronic
948282166 2:236755273-236755295 CCTAACCTCCACATCGTTCGAGG + Intergenic
1169115339 20:3061253-3061275 CATAGCCTCCACATTCTTCAAGG - Intergenic
1170419354 20:16177251-16177273 CCTAACCCCCACATTGTTCAAGG + Intergenic
1170490811 20:16872145-16872167 CCTAACATCCAGAATCTACAAGG - Intergenic
1172858470 20:38027415-38027437 CCTAACCCCCACATTGTTCAAGG - Intronic
1174361587 20:50032144-50032166 CCCAACCTCCACATCTTCCATGG - Intergenic
1174362070 20:50035128-50035150 CCCAACCTCCACATCTTCCATGG - Intergenic
1175276156 20:57772340-57772362 GCTAACCTCCAAATGCTGCCTGG - Intergenic
1175569055 20:60005328-60005350 CCTAACCCCCACATTGTTCAAGG + Intronic
1176061494 20:63174753-63174775 CCCCACCTCCGCATGCTGCAGGG + Intergenic
1177414725 21:20779056-20779078 CCTATCCTCTAAATGCTCCATGG + Intergenic
1178346678 21:31834633-31834655 CCTAACCTCCACATTATTCAAGG + Intergenic
1178417735 21:32417408-32417430 CCTAACCTCCTCTTCTTACAAGG + Intronic
1179161303 21:38901659-38901681 CCTAACCTCGACATTGTTCAAGG - Intergenic
1181869507 22:25886690-25886712 ACTAACCTCCAGATGCCAGAGGG + Intronic
1183311265 22:37110821-37110843 TCTAATATCCACATGCAACAAGG - Intergenic
1184889786 22:47372581-47372603 CATAACCTCCAGATGCATCATGG + Intergenic
949394360 3:3598812-3598834 CCTAACCCCCACATTATTCAAGG - Intergenic
949497421 3:4645712-4645734 CCTTACCTCCACCTCCCACAGGG - Exonic
950820887 3:15757320-15757342 CCTAACCTCCACATTGTTCAAGG + Intronic
951762336 3:26160728-26160750 CCTGTCCTCGAGATGCTACAGGG - Intergenic
952827375 3:37535676-37535698 CCTATCCTCCATCTGCCACATGG + Intronic
953274442 3:41481184-41481206 CCTAACCCCCACATTGTTCAGGG + Intronic
953641253 3:44710527-44710549 CCTACTCTCGACATGCTCCATGG - Intergenic
954704565 3:52472382-52472404 CCTTACCTCCACCTGATGCAGGG - Exonic
955948312 3:64216860-64216882 CCCAACCTCCACAGGATGCAAGG + Intronic
956897759 3:73681268-73681290 CCTACCCTCTACTTACTACATGG - Intergenic
959235409 3:103715573-103715595 CCTAACCCCCACATTGTTCAAGG - Intergenic
959256935 3:104027353-104027375 CCTAACCCCCACATTATTCAAGG - Intergenic
959597029 3:108140006-108140028 CCTAACCTCCACATTGTTCAAGG + Intergenic
960151134 3:114249968-114249990 CCTAACCTCCTCTTCTTACAAGG - Intergenic
963320224 3:143802831-143802853 CCTGTCCTCGAGATGCTACAGGG + Intronic
966556878 3:181272342-181272364 CCTCACCCCCACTTGCTACAGGG + Intergenic
967232511 3:187353673-187353695 CCTAACCCCCACATTGTTCAAGG - Intergenic
970621905 4:17830802-17830824 CCTCCCCTCCACCTGCTAAAAGG - Intronic
973020187 4:45195017-45195039 CTTAACCTCCTCAGGCTAGAAGG + Intergenic
973110854 4:46396208-46396230 CCTCACCTCCTAATGCCACAGGG + Intronic
973973594 4:56240272-56240294 CCTAACCTCCACATGCTACAGGG - Intronic
978277843 4:106973613-106973635 GCTAATCTCCAGAAGCTACAGGG - Intronic
978613642 4:110571777-110571799 CATCACCTGCACATACTACAGGG + Intergenic
981115648 4:140987871-140987893 CCTAATATCCACAATCTACAAGG + Intronic
982747159 4:159116198-159116220 CCTAATATCCACAATCTACAAGG + Intronic
983091461 4:163507716-163507738 CCTAACCTCTAAATGGTAGAGGG - Intronic
983692404 4:170486799-170486821 CCTAACCCCCACATTGTTCAAGG - Intergenic
984984384 4:185313707-185313729 CCTAACCCCCACATTGTTCAAGG - Intronic
986368503 5:7058484-7058506 CCTGTCCTCCAGATGCTACAGGG - Intergenic
987963851 5:24847009-24847031 CCTAACCCCCACATTATTCAAGG - Intergenic
990451781 5:55939695-55939717 CCTAACCACCACGTGCGATATGG - Exonic
990864383 5:60365033-60365055 CCTATCCTCCAAATGATAGAGGG + Intronic
990916371 5:60910146-60910168 CCTAACCTCCACACTATTCAAGG + Intronic
993261871 5:85667976-85667998 CCTAACTCCCACATTGTACAAGG + Intergenic
993462843 5:88206163-88206185 CCTAACCTACACATTCAACAGGG + Intronic
993517128 5:88851410-88851432 CCTAACCTCCACATTGTTCAAGG + Intronic
994130010 5:96216306-96216328 CCTAACCCCCACATTGTTCAAGG + Intergenic
994601306 5:101908926-101908948 CCTAACCTCCACATTGTTCAAGG + Intergenic
996358271 5:122619982-122620004 CCTGTCCTCGAGATGCTACAGGG - Intergenic
996657529 5:125959432-125959454 CCTATCATCCACATGTTACTAGG - Intergenic
996922765 5:128788302-128788324 CCCAACCTCCACATTGTTCAGGG - Intronic
998193274 5:140044201-140044223 CCTGAGCTCCACATCCTTCAAGG - Intergenic
998725702 5:145011256-145011278 CCTAAACTTCACATGCTAGTTGG + Intergenic
999257750 5:150219136-150219158 AATAACCTCCACATTGTACAGGG + Intronic
1001383746 5:171320973-171320995 CCTAACCCCCACATTGTTCAAGG + Intergenic
1001984797 5:176064199-176064221 CCTAACCCCCACATTATTCATGG - Intronic
1002232715 5:177779994-177780016 CCTAACCCCCACATTATTCATGG + Intronic
1005786091 6:29247384-29247406 CCTGCCCTCGAGATGCTACAGGG - Intergenic
1006728557 6:36217853-36217875 CCTTCCCAACACATGCTACAGGG - Intronic
1007300497 6:40864442-40864464 CCTGTCCTCGAGATGCTACAGGG - Intergenic
1008488057 6:52056429-52056451 CCTATACTCCCCATGCCACACGG - Intronic
1008810855 6:55496931-55496953 CCTAACCTCCAAATTGTTCATGG + Intronic
1009343675 6:62588671-62588693 CCTGTCCTCGAGATGCTACAGGG + Intergenic
1010071342 6:71749502-71749524 CCTATCCTCGGAATGCTACAGGG - Intergenic
1010586273 6:77661096-77661118 CCTGTCCTCGAGATGCTACAGGG - Intergenic
1013735533 6:113222503-113222525 CCTACTCTCGACATGCTCCATGG + Intergenic
1014663079 6:124198153-124198175 CCTAGCCTTCACGTGGTACATGG - Intronic
1015455005 6:133416502-133416524 CCTAACCTCCTCATGGAAAATGG - Intronic
1016204903 6:141457637-141457659 CCTGTCCTCGAGATGCTACAGGG + Intergenic
1017652176 6:156593762-156593784 CCTAACCCCCACATTGTTCAAGG + Intergenic
1017795810 6:157843243-157843265 CCTAACCCCCACATTGTTCAAGG - Intronic
1017922400 6:158883739-158883761 CCTGTCCTCAAGATGCTACAGGG - Intronic
1018436284 6:163762160-163762182 CCTAACCTCCTCTTCCTATAAGG + Intergenic
1021026131 7:15668843-15668865 CCTAACTTCCACATTATTCAAGG + Intronic
1021321012 7:19211478-19211500 CATCACCTCCACATTCTAGATGG - Intergenic
1022373214 7:29789443-29789465 CCTGTCCTCGAGATGCTACAGGG + Intergenic
1023907537 7:44533157-44533179 CCTAATCTCCACATTGTTCAAGG + Intronic
1027130923 7:75590758-75590780 CCTAAACTTTACATGTTACAGGG + Intronic
1029705149 7:102272212-102272234 CCTCACCCCCACATGCTCCTGGG - Intronic
1031108624 7:117577706-117577728 CCTAACCCCCACATTGTCCAAGG - Intronic
1031200511 7:118678319-118678341 CCTAACCTCTACATTGTTCAAGG + Intergenic
1033468518 7:141621106-141621128 CCCTCCCTTCACATGCTACATGG + Intronic
1034338398 7:150337796-150337818 CCATCCCTCCACATGCTGCAAGG + Exonic
1040062587 8:43116632-43116654 CCTAATCTCCACATTGTTCAAGG - Intronic
1040803569 8:51370010-51370032 CCTACCCTACACGTGCTACCAGG + Intronic
1042175945 8:66037065-66037087 CCTCACCTCCAGATGCTAAGTGG - Intronic
1043115621 8:76250373-76250395 CCTAACCCCCACATTGTTCAAGG + Intergenic
1045645133 8:104290543-104290565 CCTGTCCTCCAGATGCTACAGGG + Intergenic
1045993293 8:108334984-108335006 CCTAACCTCCACGTTGTTCAAGG + Intronic
1047344721 8:124015988-124016010 CCTTACCTTCACATGTCACATGG - Intronic
1047797583 8:128273626-128273648 CCAAACCCCCAAATCCTACATGG + Intergenic
1048718848 8:137299188-137299210 TCTTTCCTCCAAATGCTACATGG - Intergenic
1049336536 8:142089648-142089670 CCCAACCTCCACCAGCAACACGG + Intergenic
1052450582 9:28625111-28625133 CCTCACCACCACAAGCTAAAGGG - Intronic
1057017193 9:91663019-91663041 CCTAACCTCCACTTGCTCCTTGG - Intronic
1059588280 9:115629638-115629660 CATAATATCCACATTCTACATGG - Intergenic
1060271689 9:122147585-122147607 ACAAACCTGCACATGCTAGAAGG + Intronic
1060875183 9:127077982-127078004 CCTGATGGCCACATGCTACAGGG + Intronic
1062387807 9:136320672-136320694 CCTAATATCCACAATCTACAAGG - Intergenic
1185790468 X:2925184-2925206 CCTAATCTCCTCATCCTATAAGG - Intronic
1187984830 X:24798765-24798787 CCTAACCTCCGCATCGTTCAAGG + Intronic
1189558546 X:42169505-42169527 CCTAACCTCCACATTGTTCAAGG - Intergenic
1189779056 X:44496511-44496533 ACTAACATCCACAACCTACAAGG - Intergenic
1190823920 X:53999489-53999511 CCCAACCTCCACATTGTTCAAGG + Intronic
1191004349 X:55695072-55695094 CCTAATCTCCACATTATTCAAGG - Intergenic
1191761764 X:64654505-64654527 CCTGCCCTCGAGATGCTACAGGG + Intergenic
1194226390 X:91264715-91264737 CCTACCCTCCACACTCTAAAAGG + Intergenic
1194886645 X:99323658-99323680 CCTAACATCCAGAATCTACAAGG + Intergenic
1196217679 X:113072497-113072519 CCTCACCACCACAGGCTAAAGGG - Intergenic
1199073363 X:143503626-143503648 CCTATCCTCGGAATGCTACAGGG - Intergenic
1200448373 Y:3293607-3293629 CCTGACCTCCACATGCCCAATGG + Intergenic
1201283860 Y:12362784-12362806 CCTAATCTCCTCATCCTATAAGG + Intergenic
1201937568 Y:19424573-19424595 CCTGTCCTCAAGATGCTACAAGG + Intergenic
1202100658 Y:21304066-21304088 CCTCACCTCCTCAGGCCACAGGG - Intergenic