ID: 973976223

View in Genome Browser
Species Human (GRCh38)
Location 4:56265092-56265114
Sequence CTGTCATAATGGAAATGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 161}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973976216_973976223 17 Left 973976216 4:56265052-56265074 CCCTGGGGAGCACAGCCTATCTG 0: 1
1: 0
2: 3
3: 24
4: 179
Right 973976223 4:56265092-56265114 CTGTCATAATGGAAATGTGCTGG 0: 1
1: 0
2: 0
3: 16
4: 161
973976217_973976223 16 Left 973976217 4:56265053-56265075 CCTGGGGAGCACAGCCTATCTGA 0: 1
1: 0
2: 2
3: 11
4: 160
Right 973976223 4:56265092-56265114 CTGTCATAATGGAAATGTGCTGG 0: 1
1: 0
2: 0
3: 16
4: 161
973976219_973976223 2 Left 973976219 4:56265067-56265089 CCTATCTGACATGTGGCCAGCTC 0: 1
1: 0
2: 0
3: 5
4: 121
Right 973976223 4:56265092-56265114 CTGTCATAATGGAAATGTGCTGG 0: 1
1: 0
2: 0
3: 16
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973976223 Original CRISPR CTGTCATAATGGAAATGTGC TGG Intronic
901173126 1:7278856-7278878 CTGCCATAGAGGAAAAGTGCAGG + Intronic
903384107 1:22915656-22915678 CTGTCATAGTGGGAACGTGAGGG + Intergenic
904907567 1:33909413-33909435 ATGTCATAAAGGAAATGAACAGG - Intronic
905127807 1:35727976-35727998 CTGCCATAGAGGAAATGTTCTGG - Intronic
909279214 1:73727329-73727351 GTGTCTTAATGAATATGTGCTGG - Intergenic
910537904 1:88320504-88320526 TTGTCAAAATGGATCTGTGCTGG - Intergenic
915820064 1:159013573-159013595 CTGTCATCATGGAAGTGTACAGG + Intronic
918040296 1:180910124-180910146 CTGTGATACTGAAAATGTGCTGG - Intergenic
919608966 1:199721493-199721515 CTATCATGATTTAAATGTGCTGG + Intergenic
920254868 1:204647805-204647827 CAGTCCAAATGGAGATGTGCTGG + Intronic
920623085 1:207568096-207568118 CTGTAATTATGGAAATATGGAGG - Intronic
924636668 1:245794581-245794603 CTGTCAAATTGAAAATTTGCTGG + Intronic
1063201723 10:3790775-3790797 CTGTTGTGATGGAAGTGTGCCGG + Intergenic
1063814383 10:9756103-9756125 ATCTCATAATGGAGATTTGCTGG + Intergenic
1070350147 10:75583934-75583956 CTGTCATCAAGGAACTGTGTGGG - Intronic
1072533342 10:96340117-96340139 CTGACATTTGGGAAATGTGCAGG + Intergenic
1074312978 10:112338418-112338440 CTGTGATGATGGAAATGTCGCGG - Intergenic
1075018182 10:118926587-118926609 CAGTAATGAAGGAAATGTGCTGG + Intergenic
1075109481 10:119566569-119566591 CACTCCTAATGGGAATGTGCTGG - Intergenic
1075201501 10:120408490-120408512 CGGTCACAATGGAACTGTGATGG + Intergenic
1085602312 11:77866222-77866244 CTGGCATAATGGATATTAGCTGG + Intronic
1088083090 11:105944176-105944198 CAGCCATTATGAAAATGTGCAGG - Intronic
1089042625 11:115467529-115467551 ATCTCAGAATGGAAATGTCCTGG - Intronic
1089213222 11:116820200-116820222 CTTTCATAATGGAACTGGGGTGG + Intergenic
1089247700 11:117134541-117134563 TTGTGATAATGGAATTGTTCTGG - Intergenic
1089259022 11:117210004-117210026 TTGTGATAATGGAATTGTTCTGG + Intronic
1090200694 11:124853383-124853405 CAGTCACAATGGAGATGGGCAGG + Intergenic
1091023225 11:132119654-132119676 CAGTCACAATGGAAATAAGCTGG + Intronic
1091597125 12:1885646-1885668 CTGACATAATGGAAAGGTCCAGG + Intronic
1091674274 12:2477421-2477443 CTGGCTTAATGGAAAGGTGATGG + Intronic
1093042528 12:14400367-14400389 CTGTCTTCATGGAAATGTTATGG - Intronic
1093451299 12:19318165-19318187 CTGTCATAAAAGCAATGTGTGGG + Intronic
1096397210 12:51275348-51275370 CTGACAAAATGGTAATGTCCAGG - Intergenic
1100666098 12:96755101-96755123 CTATGATAATGCAAATGCGCTGG - Intronic
1101403722 12:104410339-104410361 CTCCCATAATGGAAAAGTGTAGG - Intergenic
1102395409 12:112581502-112581524 CTGCCTTTATGGAAATGAGCAGG + Intronic
1104337400 12:127912463-127912485 GTGTCATAAATGAAATGTGCTGG + Intergenic
1105787324 13:23762472-23762494 CTGTCATAAGGAAGGTGTGCAGG + Intronic
1106001371 13:25726692-25726714 GTGGCAAAAAGGAAATGTGCAGG - Intronic
1106831302 13:33586297-33586319 CTGGGATAATGGAAATATCCTGG - Intergenic
1106992285 13:35435521-35435543 TAGTGATAATGGATATGTGCAGG + Intronic
1110811466 13:79815478-79815500 CTTTCATCATGGAAAGGTGCTGG + Intergenic
1112306477 13:98279473-98279495 CTGTGATGATGGAAATGTTCTGG + Intronic
1112355256 13:98669217-98669239 CTGGCATCATGAAACTGTGCAGG + Intergenic
1113134507 13:107074682-107074704 ATGTCATAATGTAAATTTACTGG + Intergenic
1113748014 13:112758812-112758834 CTGAGATAATGTAACTGTGCAGG - Intronic
1115622972 14:35158989-35159011 CTGGAATGATGGAAATGTGTGGG - Intronic
1116832857 14:49739515-49739537 GTGTGACAATGGAAATGTGAAGG + Intronic
1118238518 14:64034629-64034651 CTTTAATATTGGAAATGTTCAGG + Intronic
1124258015 15:28161714-28161736 TTGTCATTGTGGAAATGTTCTGG - Intronic
1126220444 15:46207124-46207146 GTGTCATAAGGCAAATGTTCTGG + Intergenic
1131947739 15:97645774-97645796 CTGTTATAATGGATATGTACTGG - Intergenic
1134679697 16:16115761-16115783 CTGTCATAATAGAAATTTAGAGG + Intronic
1135396738 16:22137405-22137427 GTCTCATAATGGAAGGGTGCTGG + Intronic
1138440605 16:57032676-57032698 CTGCAATGATGGAAATGTCCTGG - Intronic
1139716505 16:68817753-68817775 CTGACATTTTTGAAATGTGCTGG - Intronic
1139927561 16:70498912-70498934 CTGTGATAATGAAAATATTCTGG + Intronic
1141787264 16:86209943-86209965 CTGGGGTAATGGAAATGTCCTGG - Intergenic
1144452365 17:15391570-15391592 CTGCCAGGATGGAACTGTGCTGG - Intergenic
1144930607 17:18856014-18856036 CTTCCATAATAGAAATGTCCAGG + Intronic
1151751442 17:76040674-76040696 CTGTCCTCATGCAACTGTGCTGG - Intronic
1152854178 17:82654478-82654500 CTGTCATCATGGGAATGTAGAGG + Intergenic
1155822402 18:30394991-30395013 CTCTCAACATGGAAATTTGCTGG - Intergenic
1155873715 18:31058722-31058744 CTGTAATGATGTAAATGTGAAGG + Intergenic
1156461194 18:37322272-37322294 CTGCCTTTATGGAAATGAGCTGG + Intronic
1156875171 18:42001800-42001822 CAGTCTTAATAGAAATGTGCGGG - Intronic
1158530782 18:58258269-58258291 CTGTCATGATGGTAATTTGTTGG - Intronic
1159068645 18:63597177-63597199 CTGCCACAAAGGAACTGTGCAGG - Exonic
1159240888 18:65742063-65742085 ATGTAATAATGCAAATGGGCTGG + Intergenic
1159643502 18:70890375-70890397 CTGTCACTATAGAAATATGCAGG + Intergenic
1164862018 19:31569091-31569113 CTGGCATAGTGGGAATGTTCAGG - Intergenic
926451155 2:13005880-13005902 CGGCCATAAAGGATATGTGCAGG - Intergenic
928050994 2:27995212-27995234 CTGGCAAAGTGGAAATGGGCTGG + Intronic
928406764 2:31020878-31020900 TTGGCATTATAGAAATGTGCAGG - Intronic
929030630 2:37647253-37647275 CAGTCCTAAAGGAAAGGTGCTGG + Intronic
932286864 2:70541898-70541920 CTGTCATTGTTGAAATTTGCTGG + Intronic
937297276 2:120817392-120817414 CTGTCATGATGGGCATGTGATGG - Intronic
937699707 2:124850568-124850590 CTGTAATAATAGAAATTTGGAGG - Intronic
939532448 2:143381580-143381602 CTGTAAAAATGGAAGTGTGCAGG - Intronic
941754346 2:169168586-169168608 CCGCCATATTGGAAATGTGATGG - Exonic
945523335 2:210857516-210857538 ATGTCTTAATGGAAATGGACAGG - Intergenic
1169518805 20:6349115-6349137 CTGTCATAATGTCCCTGTGCTGG + Intergenic
1170103378 20:12726911-12726933 CAGCCATAATGGAAATGGCCTGG + Intergenic
1170765139 20:19283494-19283516 CTGTGATGATGGAAATGTTTTGG - Intronic
1172913617 20:38428159-38428181 ATGTCATAATGGAAAGTGGCTGG - Intergenic
1175067775 20:56304780-56304802 CTGTAAAAATGCAAATGTGGTGG + Intergenic
1177676092 21:24301027-24301049 ATGTCATAATAAAAATGTACAGG - Intergenic
1181627854 22:24133595-24133617 CTGTCCTAAAGGAAAAGGGCTGG - Intronic
1184258296 22:43299732-43299754 CTGGCATGATGGAAATATTCTGG - Intronic
1185104539 22:48859848-48859870 CTGTCATATTAGAAATGCACGGG + Intergenic
951358756 3:21700794-21700816 ATGTCATGATTGAAATGTACAGG + Intronic
952875079 3:37937954-37937976 CTCTCACAATATAAATGTGCTGG - Intronic
958058933 3:88452215-88452237 CTGTCATAAGGGAAGAGAGCAGG + Intergenic
960443335 3:117716590-117716612 CTGCCTAAATGGAAATTTGCAGG - Intergenic
960696105 3:120398137-120398159 CTGGGATAATGAAAATGTTCTGG + Intronic
960863340 3:122175125-122175147 CTGTCATAATATTAATGTACAGG - Intergenic
960984463 3:123265347-123265369 TTGTCAGAAAGGAAGTGTGCAGG + Intronic
962994767 3:140614869-140614891 CAGTCATAAAGGAAATGGGTTGG + Intergenic
964085539 3:152813179-152813201 ATGGCATAATAGAAATGTCCAGG + Intergenic
965625308 3:170678727-170678749 CTGTAATAATGGTGATGTCCTGG - Intronic
967408120 3:189139797-189139819 CTGTTAACATGGAAATGTACCGG + Intronic
971088684 4:23312761-23312783 CTATAATAATGGTAATGTACAGG + Intergenic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
973976223 4:56265092-56265114 CTGTCATAATGGAAATGTGCTGG + Intronic
976338335 4:83916879-83916901 CTGTCTTAATGGATAGGTGAAGG - Intergenic
978639436 4:110852239-110852261 CTGTCATAATATACCTGTGCAGG - Intergenic
979843946 4:125484403-125484425 CTGTAATAATAGTAATGTGATGG + Intronic
980244824 4:130224988-130225010 CTGTCTTTGTGGAAATGTTCGGG + Intergenic
980334416 4:131452069-131452091 GAGTCATAATGGAAATGAGTTGG - Intergenic
982632574 4:157850168-157850190 CTGTCATAGTGGGGATGTGTTGG + Intergenic
984124778 4:175794609-175794631 ATGTCATTATAGAAATGTACTGG + Intronic
984649219 4:182251506-182251528 CTGTTAAAATGGAAAAGTGTGGG + Intronic
987322288 5:16781723-16781745 CTGTCAGAAAGGAAATATTCAGG - Exonic
987857159 5:23435308-23435330 CTGTCTTAAGGCAAATATGCTGG - Intergenic
990301795 5:54456188-54456210 CTGTCATGATGGAATTTTGGTGG + Exonic
990407046 5:55502186-55502208 CTGTGATAAAAGAAATGTCCAGG + Intronic
991625408 5:68595861-68595883 GTTTCATAATGGCCATGTGCAGG - Intergenic
992972025 5:82071272-82071294 CTGTCAAAATGGAAAGCTGGGGG - Intronic
993566702 5:89485281-89485303 CTGTCATAATGGCATTGTAAAGG - Intergenic
993824331 5:92662951-92662973 CTGTCATAATGACCATCTGCTGG - Intergenic
995609206 5:113890955-113890977 AAGTCATAAGGGAAATGGGCAGG + Intergenic
998277513 5:140770823-140770845 CTGTAGTAATGGAAATGTTCTGG - Intergenic
999040120 5:148400012-148400034 CTGGAATACTGGAATTGTGCAGG + Intronic
999182538 5:149680412-149680434 CTGCCAAAAGGGAAATGGGCAGG - Intergenic
1001219460 5:169887188-169887210 CTTTCAGAATGAAAATGTGGAGG - Intronic
1002842989 6:922153-922175 CAGGCATAATGTAAATGGGCAGG + Intergenic
1002878086 6:1228761-1228783 CTGTCATAATGGGGAGGTGGAGG - Intergenic
1008637050 6:53420912-53420934 TTGAGATGATGGAAATGTGCAGG - Intergenic
1008699998 6:54087542-54087564 CTGACTTACTGGAAATGTGTTGG - Intronic
1010658127 6:78536732-78536754 CTATCATAAAGGAAATAAGCTGG + Intergenic
1012760670 6:103296590-103296612 CTTTCATAATGGAAATTTTTTGG + Intergenic
1013733032 6:113192059-113192081 CTGTCAAAATAGAAATTAGCTGG + Intergenic
1013917115 6:115354188-115354210 CTGCAATAATGGAAATGTTCTGG + Intergenic
1014172005 6:118288945-118288967 CTGTGCTGATGGAAATGTTCTGG - Intronic
1015115525 6:129644762-129644784 CTATCTTAATGGAAATTTACTGG - Intronic
1015835617 6:137417142-137417164 CTGTCATAATAACAAAGTGCAGG - Intergenic
1016544786 6:145208835-145208857 ATGTTATAATGGCAATGTGCAGG - Intergenic
1017315840 6:153030280-153030302 CTGTCATCATGGATATGCGCAGG + Intronic
1019066132 6:169300204-169300226 CTGTCAGAATGGCAACCTGCAGG - Intergenic
1020491100 7:8785443-8785465 CTGTCATTTTGGAATTGTGTTGG - Intergenic
1020633238 7:10666024-10666046 CTCTAATAATGGAAATGTTTTGG - Intergenic
1023599540 7:41867758-41867780 TTGTCATAATGAAAATGTGAGGG - Intergenic
1025965492 7:66266199-66266221 CTGAAATATGGGAAATGTGCAGG - Intronic
1027600915 7:80239609-80239631 CTTTCATAATGGAATTTTGGAGG - Intergenic
1036186318 8:6625406-6625428 TTGTTATAATGGAAATGAACGGG - Intronic
1038618437 8:29117113-29117135 CTGTCATAGTAGAACTTTGCTGG - Intronic
1038964600 8:32557749-32557771 CAGGCATTATGGAAATGAGCGGG + Intronic
1041259674 8:56009989-56010011 ATGACATTATGAAAATGTGCTGG + Exonic
1041824367 8:62076303-62076325 CTGCTATAATGGAGATGTTCAGG - Intergenic
1044489474 8:92795311-92795333 CTGTCAAAATGGAATCTTGCTGG - Intergenic
1045153548 8:99437887-99437909 CTGATAAAATAGAAATGTGCTGG + Intronic
1046249141 8:111608094-111608116 GTGACATAGTGGAAATATGCTGG + Intergenic
1046682013 8:117181104-117181126 CAGTTATAATGCAAATGTGTAGG + Intergenic
1051980094 9:23003639-23003661 ATTTCAAAATGGAAAAGTGCAGG - Intergenic
1053208407 9:36207352-36207374 CTGTAATAGGGGAAATGTTCTGG - Intronic
1053311095 9:37020555-37020577 CTGTCATATTGGACAGCTGCTGG + Intronic
1054766922 9:69049742-69049764 CTGGAATAATGAAAATGTTCTGG - Intronic
1055349858 9:75375523-75375545 GTTTCAGAATGGAAATGTTCTGG + Intergenic
1055917282 9:81417637-81417659 CTGTCAAAATGGAAATGTCTTGG + Intergenic
1058292906 9:103265279-103265301 CTTTAATAATGGAAATGTTATGG - Intergenic
1058840121 9:108898808-108898830 GTATCATAATGAAAATATGCTGG - Intronic
1187089614 X:16081988-16082010 CTCCCATAATGGAGATGTGTGGG + Intergenic
1187774421 X:22739646-22739668 CTGTCATAATGAAAATATGTAGG + Intergenic
1188735314 X:33706033-33706055 CTGTGATAATGTAAATGTTTAGG - Intergenic
1188796378 X:34471394-34471416 GTGACATAATGGGAATGGGCTGG + Intergenic
1191084885 X:56554906-56554928 CTTTGAGAAGGGAAATGTGCTGG + Intergenic
1192938697 X:75889476-75889498 CTGCCATAGTGAAAATGTGGAGG + Intergenic
1194726543 X:97404645-97404667 GTGTCATATTGGAAATGTTAGGG + Intronic
1194758573 X:97766793-97766815 CTCTAATAATGGAGATGGGCAGG - Intergenic
1194899237 X:99487471-99487493 CTGTCAAAATGGAAATTTCAAGG + Intergenic
1195200509 X:102546103-102546125 CTGCCATCATGAAAATGTGGAGG - Intergenic
1196200045 X:112875995-112876017 CTGGCATGATGCAAATGTGATGG - Intergenic
1197183192 X:123559220-123559242 CTGTCTTAATAGAAAAGAGCTGG - Intergenic
1199725118 X:150572461-150572483 CTGTCATCATTAAAATATGCAGG + Intronic
1202101737 Y:21315901-21315923 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202187562 Y:22202869-22202891 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202188511 Y:22215689-22215711 GTCTTCTAATGGAAATGTGCTGG - Intergenic
1202203798 Y:22383527-22383549 GTCTTCTAATGGAAATGTGCTGG + Intronic