ID: 973981776

View in Genome Browser
Species Human (GRCh38)
Location 4:56314037-56314059
Sequence TAGGATCCACAACATGAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973981776 Original CRISPR TAGGATCCACAACATGAGCA AGG Exonic
904382689 1:30122050-30122072 TGGGAGCCCCATCATGAGCATGG + Intergenic
909768074 1:79383301-79383323 TGGAGTCCAAAACATGAGCAAGG - Intergenic
910080341 1:83334288-83334310 TAGGGTCCACCACCTGAGCTGGG - Intergenic
917434438 1:175005277-175005299 TCCCAACCACAACATGAGCAAGG - Intronic
920057821 1:203205689-203205711 TTGGCTCCATAACATGAGCCAGG - Intergenic
923673716 1:236063593-236063615 TAAAATCCACAAGATGACCAAGG - Intronic
1064938199 10:20703916-20703938 TAGGAGCCACACCAGGAGCCAGG - Intergenic
1066389047 10:34964195-34964217 CAGGATCCAGAACCCGAGCAGGG + Intergenic
1069187623 10:65445345-65445367 TAAGATGCACAACATAATCAGGG + Intergenic
1078935569 11:15946582-15946604 TAAGATGCACAACATTAGCCTGG - Intergenic
1092944710 12:13441912-13441934 GAGGATCCACCAGATGAGGAAGG - Intergenic
1098458536 12:70704475-70704497 GAGGATCCAGAACATCATCAGGG + Intronic
1102860045 12:116328302-116328324 TAGCATCCACACCATCAGAATGG + Intergenic
1104616635 12:130275835-130275857 TTTAATCCACACCATGAGCAAGG - Intergenic
1106315310 13:28588136-28588158 TAGCTTCCAGAACATGAGCCTGG + Intergenic
1108853236 13:54761870-54761892 TTGGTTCCACAGCATGGGCATGG - Intergenic
1110071731 13:71186193-71186215 TACCATTCACAACATAAGCATGG + Intergenic
1110462851 13:75765412-75765434 TTGGATCTGCAACTTGAGCATGG + Intronic
1111911947 13:94322758-94322780 TAGGCTCCACAAAAGCAGCAGGG + Intronic
1114714280 14:24807974-24807996 TAGAAAACACAACATGACCAAGG + Intergenic
1119860862 14:77935073-77935095 TGGGATCTAAAACATCAGCATGG + Intergenic
1121687983 14:95853663-95853685 AAGGATCCACAAGATGCCCATGG - Intergenic
1123443684 15:20306762-20306784 GAGGATCCAGAGCAAGAGCAGGG - Intergenic
1125301809 15:38262683-38262705 TATGAGACACAATATGAGCATGG + Intronic
1130577864 15:85108237-85108259 TCGGATCCTGTACATGAGCAGGG + Intronic
1135848455 16:25940479-25940501 AGGGATTTACAACATGAGCAGGG + Intronic
1136187529 16:28596938-28596960 TTGGAGCCACAAGCTGAGCAGGG + Intronic
1136316940 16:29460022-29460044 TTGGAGCCACAAGCTGAGCAGGG - Intronic
1136431515 16:30199364-30199386 TTGGAGCCACAAGCTGAGCAGGG - Intronic
1139193113 16:64887746-64887768 TAGTAACTACAACATAAGCATGG - Intergenic
1147361289 17:39932237-39932259 TAATATCCACAACATGAGGAGGG - Intergenic
1154164556 18:12004818-12004840 TAGAATCCACAATATAGGCAGGG - Intronic
1155603026 18:27571177-27571199 TAAAATCCACAACTTGGGCATGG + Intergenic
1162971595 19:14184043-14184065 TCGCATCCTCACCATGAGCAAGG + Intronic
928435781 2:31253691-31253713 GAGGGTCCACACCCTGAGCAAGG - Intronic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
931135759 2:59398835-59398857 TAGGAGCAAGAACAAGAGCAGGG + Intergenic
939431259 2:142111470-142111492 TAGGAAGCAAAACATGATCATGG + Intronic
941513749 2:166445944-166445966 TACGATTCAGAACATAAGCATGG + Intronic
941802913 2:169680684-169680706 AAGGATCCAGAAGAGGAGCAGGG + Intronic
946416407 2:219542170-219542192 TAGGACCCGCTACATCAGCACGG - Exonic
1169530617 20:6481254-6481276 GAGGTTCCACAAGATGAGGAAGG + Intergenic
1171354308 20:24532461-24532483 AAGGAACCACATCATGGGCATGG + Intronic
1171393412 20:24815795-24815817 TAGGATACAAAACAAGAGCCAGG - Intergenic
1176349679 21:5782569-5782591 CAGGACCCATAACATGGGCAGGG + Intergenic
1176356493 21:5903153-5903175 CAGGACCCATAACATGGGCAGGG + Intergenic
1176544000 21:8180639-8180661 CAGGACCCATAACATGGGCAGGG + Intergenic
1176562951 21:8363684-8363706 CAGGACCCATAACATGGGCAGGG + Intergenic
1181313457 22:21957733-21957755 CAGGAGCCGAAACATGAGCAAGG - Intronic
1181346563 22:22223805-22223827 CAGGAGCCGAAACATGAGCAAGG - Intergenic
1203248869 22_KI270733v1_random:96862-96884 CAGGACCCATAACATGGGCAGGG + Intergenic
950987410 3:17389700-17389722 TTGAATCTACAACTTGAGCAGGG - Intronic
952156225 3:30646544-30646566 GAGGATCCATAACATTTGCAAGG + Intronic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
955132593 3:56185950-56185972 TAGGGGCCACATCATGTGCAAGG + Intronic
958551233 3:95616165-95616187 TAGCAGTCACAACATGAGGAAGG + Intergenic
959664621 3:108906646-108906668 TAAGAGCCAGAACATCAGCAAGG - Intergenic
967679113 3:192339066-192339088 TATGAACCACAACATGATAATGG + Intronic
969450490 4:7270169-7270191 TAAAATCCACATCATGGGCACGG - Intronic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
975721192 4:77250196-77250218 TAGAAACCACAACTAGAGCATGG + Intronic
976079149 4:81335411-81335433 TAGGGTCTAAAAAATGAGCAAGG - Intergenic
990238862 5:53797216-53797238 GAGGCTCAACAACATCAGCAAGG + Intergenic
991090110 5:62686124-62686146 TACTATCCACAGCATTAGCAGGG + Intergenic
991937733 5:71818403-71818425 AGGGACCCAAAACATGAGCAGGG - Intergenic
997719335 5:136065349-136065371 TAGGATACCCAGCATGAGCAAGG - Intergenic
1001233418 5:170009475-170009497 GAGGATTCAGGACATGAGCAAGG - Intronic
1003989279 6:11469859-11469881 AAGGAGCAAAAACATGAGCATGG + Intergenic
1011109237 6:83818659-83818681 TAGGATCTACACCCTCAGCAAGG - Intergenic
1013702813 6:112794812-112794834 TTGGCCACACAACATGAGCAGGG + Intergenic
1015250911 6:131126773-131126795 TTGTAACCACACCATGAGCAGGG - Intergenic
1016722438 6:147317467-147317489 TAGTAGACACAACATGAGGAAGG + Intronic
1016895968 6:149053432-149053454 TATGACCCTGAACATGAGCATGG - Intronic
1018038331 6:159900357-159900379 AAGAATCCACAAAATGACCAAGG + Intergenic
1019812559 7:3175276-3175298 TAGGATCCTCATCATGAGAAAGG + Intergenic
1027298114 7:76799554-76799576 TAGGGTCCACCACCTGAGCTGGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1029340568 7:99940527-99940549 TAGGAAGCACAACATAAGAATGG - Intergenic
1031466115 7:122114358-122114380 TAGGAGCAACAACATCACCAGGG - Intronic
1033742344 7:144284713-144284735 TGGGAACCACTACACGAGCATGG + Intergenic
1033751558 7:144364901-144364923 TGGGAACCACTACACGAGCATGG - Exonic
1034114193 7:148568369-148568391 TAGGATCCACCACCTGAGATGGG - Intergenic
1035040583 7:155923988-155924010 TGGGATCCACCAGACGAGCATGG - Intergenic
1041779656 8:61563811-61563833 TATTATCCACAACAAAAGCATGG + Intronic
1043383387 8:79726244-79726266 TTGGATTCACAACATGGCCAGGG - Intergenic
1048187170 8:132251957-132251979 AAGGATCCAGAAGATGAGAAAGG - Intronic
1050500846 9:6295897-6295919 TAGGATCCACCTCTGGAGCAGGG + Intergenic
1055395665 9:75871607-75871629 TAGTATTCACACCATGAACACGG - Intergenic
1056319505 9:85423105-85423127 TAGGACCCACAAGCTGAGAATGG - Intergenic
1203465269 Un_GL000220v1:80110-80132 CAGGACCCATAACATGGGCAGGG + Intergenic
1187562354 X:20414743-20414765 CAGAATCCACAGGATGAGCATGG - Intergenic
1189046921 X:37603199-37603221 CAGGATCTAAAAGATGAGCAGGG + Intronic
1194727981 X:97420759-97420781 TAGAATCCACAGGATGAGCTAGG - Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1202025976 Y:20524417-20524439 TAGGTTCGACAACATCACCAAGG - Intergenic
1202099051 Y:21286576-21286598 TAGGATCAATAACATGAAAATGG + Intergenic