ID: 973981864

View in Genome Browser
Species Human (GRCh38)
Location 4:56314477-56314499
Sequence GCCTCTCCTCCGCTTGGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 213}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973981864_973981873 4 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981873 4:56314504-56314526 GCTGGAGGAGGACGCCAGGCTGG 0: 1
1: 0
2: 6
3: 57
4: 487
973981864_973981879 22 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981879 4:56314522-56314544 GCTGGAGGAGCGGAGGCGGCAGG 0: 1
1: 1
2: 8
3: 99
4: 797
973981864_973981875 12 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981875 4:56314512-56314534 AGGACGCCAGGCTGGAGGAGCGG 0: 1
1: 0
2: 6
3: 37
4: 760
973981864_973981872 0 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981872 4:56314500-56314522 GGCGGCTGGAGGAGGACGCCAGG 0: 1
1: 1
2: 4
3: 42
4: 446
973981864_973981874 7 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981874 4:56314507-56314529 GGAGGAGGACGCCAGGCTGGAGG 0: 1
1: 0
2: 5
3: 76
4: 625
973981864_973981880 25 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981880 4:56314525-56314547 GGAGGAGCGGAGGCGGCAGGAGG 0: 1
1: 0
2: 21
3: 181
4: 1401
973981864_973981876 15 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981876 4:56314515-56314537 ACGCCAGGCTGGAGGAGCGGAGG 0: 1
1: 0
2: 5
3: 24
4: 346
973981864_973981878 18 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981878 4:56314518-56314540 CCAGGCTGGAGGAGCGGAGGCGG 0: 1
1: 0
2: 4
3: 91
4: 790
973981864_973981871 -8 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981871 4:56314492-56314514 GGAGAGGCGGCGGCTGGAGGAGG 0: 1
1: 1
2: 16
3: 114
4: 1254
973981864_973981881 28 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981881 4:56314528-56314550 GGAGCGGAGGCGGCAGGAGGAGG 0: 1
1: 0
2: 17
3: 164
4: 1594

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973981864 Original CRISPR GCCTCTCCTCCGCTTGGGCC TGG (reversed) Exonic
900158874 1:1214064-1214086 GGCTCTGCTCCTCCTGGGCCTGG - Exonic
900215337 1:1478685-1478707 TCCTCTCCTCAGCCTGCGCCCGG - Exonic
900218338 1:1494290-1494312 CCCTCTCCTCTGCTGGGCCCTGG + Intronic
900222598 1:1517352-1517374 TCCTCTCCTCAGCCTGCGCCCGG - Exonic
900326968 1:2113100-2113122 GCCTCTCCTGCTCTGGAGCCGGG + Intronic
900506650 1:3032693-3032715 CCCTCACCTCCTCTTGGGGCTGG - Intergenic
900791789 1:4685654-4685676 GCCTCTCCTTCGCTGGGGCAGGG - Intronic
901337346 1:8462539-8462561 GCCTCTGCACCTCCTGGGCCTGG - Intronic
901686618 1:10946956-10946978 GCATCCCCTCTGCCTGGGCCGGG + Intronic
902402836 1:16167498-16167520 GCCTCTCCTCCACGTGGCCCGGG - Intergenic
903878411 1:26492046-26492068 GCTTCTGCTCCTCTTGTGCCCGG + Intergenic
903880919 1:26508626-26508648 GCCTCTCCTTCTCTGGGGCATGG + Intergenic
903925124 1:26826600-26826622 GCGCCCCCTCCGCCTGGGCCCGG - Intergenic
904113565 1:28145473-28145495 GCCTCGCCTCCCCGAGGGCCAGG - Intergenic
904580716 1:31541837-31541859 GCCTTTGCTCCTCCTGGGCCTGG + Intergenic
905878011 1:41445707-41445729 GCCTCTGCTCAGCCTGGCCCAGG - Intergenic
906560924 1:46756238-46756260 GCCTCTGCTTCACCTGGGCCTGG + Intergenic
909344558 1:74571027-74571049 GGGTCTCCTCCCCTTGGGGCTGG - Intronic
909622547 1:77683683-77683705 GCCTTTCCTCTGCTAGGGCCAGG - Intergenic
912211693 1:107563750-107563772 GACTCTCCCCCAGTTGGGCCTGG + Intergenic
913274170 1:117121708-117121730 GCCTCTCCCGCGCCTCGGCCCGG + Exonic
915147540 1:153803943-153803965 TCCTCTTCTCTGGTTGGGCCTGG + Intergenic
915244160 1:154544407-154544429 GCTGCTCCTCCGCCTGAGCCAGG - Exonic
919639347 1:200034128-200034150 CCCTCTCCTCCGCTTCAACCTGG - Intronic
920335019 1:205239294-205239316 GTCTCACATCAGCTTGGGCCTGG + Intronic
923680101 1:236112060-236112082 GCCTCCCCACCTCTGGGGCCAGG + Intergenic
1062768806 10:84039-84061 CCCTCTCCACTGCTTGGTCCTGG - Intergenic
1064103944 10:12485488-12485510 CCCTCTCCTCCACCTGGGACAGG - Intronic
1069808080 10:71138359-71138381 GCCTCTCCTGGGCTTTGGCTGGG - Intergenic
1069867481 10:71512669-71512691 TCCTCTCCTGCCCTTGGGCTGGG + Intronic
1070777910 10:79120789-79120811 GCTTCTCATCCCCTGGGGCCTGG + Intronic
1072031766 10:91528508-91528530 GCCTCTCTTCACCTTGGGCTGGG + Intergenic
1073124322 10:101140295-101140317 GACTCTCCTGCCCTTGGGCTAGG + Intergenic
1073176140 10:101558851-101558873 GCCTCTCCTTCCCTGGGCCCGGG - Intergenic
1073257144 10:102160043-102160065 GCCTCCCCTCAGCGTGGGTCTGG + Intronic
1074051926 10:109888058-109888080 GCCTCTCCTCACACTGGGCCTGG - Exonic
1074160097 10:110829889-110829911 GCCTCTCTTCTGCTGGGGCTGGG - Intronic
1075040573 10:119104242-119104264 GCCTCTGCTCCACCTCGGCCCGG + Intronic
1075280862 10:121137028-121137050 GCCTCCCCTCCTCTTAAGCCAGG - Intergenic
1077037507 11:502531-502553 GCCTCTCATTTGCTTGGGCAAGG + Exonic
1083475838 11:62914844-62914866 GCCTCTCATCTGCCTGGGCATGG + Intronic
1083555461 11:63622634-63622656 GCCTGTCCTCCCCTGGGGCATGG + Intergenic
1085040442 11:73323632-73323654 GCCCCTCCTCCCCTCTGGCCTGG + Intronic
1087013910 11:93538235-93538257 GCCTCGACTCCTCTTGGGGCTGG + Intronic
1089127377 11:116186220-116186242 GCCTCTCCTCCTTGTGCGCCAGG - Intergenic
1090838335 11:130469464-130469486 GCCTCACCTCCCCTGGGCCCAGG - Intronic
1091393524 12:139973-139995 TCCTTTCCTCTGCTTGGGACTGG - Intronic
1091807051 12:3364344-3364366 TCCCCTCCTCAGCTGGGGCCAGG + Intergenic
1093401309 12:18750211-18750233 CCCTCTCCTCCGCTTGTGTCAGG + Intergenic
1096521486 12:52187082-52187104 GCCTCTCCTCCCTTGGTGCCAGG + Intronic
1096653113 12:53071851-53071873 CCCTCACCCCAGCTTGGGCCAGG - Intronic
1096780559 12:53989490-53989512 GCCCCTCCTCCCTTTGTGCCTGG + Exonic
1096809235 12:54159165-54159187 CCCTCTCCTCCGCTGGGGCTGGG - Intergenic
1097224796 12:57470985-57471007 GGCTCTCTGCCTCTTGGGCCTGG + Exonic
1098886985 12:75970158-75970180 GCCTCTCCTCCTCTGTGGCTGGG - Intergenic
1100423416 12:94459833-94459855 CCCACTCCTCCGCGTGGACCGGG + Exonic
1102508991 12:113401833-113401855 GATTCTCCTCAACTTGGGCCGGG + Intronic
1111337374 13:86840782-86840804 GCCTCACCACAGCTTGGGGCGGG + Intergenic
1111908917 13:94288215-94288237 GCTTCTCCTCCCCCAGGGCCTGG + Intronic
1112365423 13:98752134-98752156 GCCCCATCTCCTCTTGGGCCAGG + Intronic
1113778374 13:112961787-112961809 GCCTCTCCTGGGCTGGGGCGAGG - Intronic
1118723316 14:68609240-68609262 GCCGCACCTCCTCTGGGGCCTGG - Intronic
1119706276 14:76784540-76784562 GCCTCTCCTCATCTTCTGCCAGG - Intergenic
1119855384 14:77896547-77896569 GGCTGGCCTCCGCCTGGGCCTGG + Intronic
1120146239 14:80982017-80982039 GACTCTTTTCCGCTTTGGCCTGG - Intronic
1121679083 14:95777551-95777573 GCCCTTCCTCCCCCTGGGCCTGG + Intergenic
1122481863 14:102052477-102052499 GCCCCTGCTCCTCTTGGGCTGGG + Intergenic
1122603481 14:102932642-102932664 GCTTGTCCACAGCTTGGGCCAGG - Exonic
1122838736 14:104444063-104444085 GCCCCTCCTCCCCCAGGGCCTGG - Intergenic
1122975808 14:105170294-105170316 ACCTCTCCTGTGCTTTGGCCTGG + Intergenic
1124874597 15:33580057-33580079 GCATCTCCTCCTCTGGGGGCTGG - Exonic
1125297735 15:38221213-38221235 CCCTCTCCTTAGCTTAGGCCTGG - Intergenic
1126110966 15:45174497-45174519 CCCTCTCCCCTGCTTGGGCAAGG - Intronic
1127117440 15:55742624-55742646 GCCTCTGCGCTGCTTGGGCAGGG - Intronic
1129248609 15:74295648-74295670 GCCTCTCCTCCTCATGGCTCAGG - Intronic
1129851963 15:78798609-78798631 GCATCTCCTCCGCTCGGGTGTGG - Intronic
1131222544 15:90597118-90597140 GCCTCTCCTCCGCCTGTGTGGGG - Intronic
1132465685 16:76460-76482 GCCTCTCCACCTCCTGGGGCAGG + Intergenic
1132500584 16:283033-283055 GCCTCCCCTCCCCTGGGGGCCGG + Intergenic
1132719754 16:1309826-1309848 GCCTCTACTCCTGTTGGGCCCGG + Intronic
1132959198 16:2612783-2612805 GCTTCTCCAGCGCTTGGCCCTGG + Intergenic
1132972258 16:2694758-2694780 GCTTCTCCAGCGCTTGGCCCTGG + Intronic
1133332269 16:4982120-4982142 GCCTGTCCTCCACCAGGGCCAGG - Intronic
1134187862 16:12098619-12098641 CCCTCTCCTCCTCTTTTGCCTGG + Intronic
1135424744 16:22326820-22326842 GCCACGCCCCAGCTTGGGCCTGG + Intronic
1135745819 16:25015339-25015361 GCCGCGCCGCCGTTTGGGCCGGG - Intronic
1138303581 16:55954631-55954653 GCCTCTCCTCAGCTTGGTGCGGG + Intronic
1139549999 16:67667729-67667751 GCCTCTAAGCCTCTTGGGCCTGG + Intronic
1140891389 16:79288226-79288248 GTATCTCCTCCCCTTGAGCCTGG + Intergenic
1141704008 16:85654902-85654924 GCCTCCCCTCGGCCTGGACCCGG + Exonic
1142165168 16:88582801-88582823 GCCTCACGCCAGCTTGGGCCAGG - Intronic
1142314119 16:89332692-89332714 GGCTCTCCTCCGGCAGGGCCTGG + Intronic
1143963346 17:10738604-10738626 GCCTTTCCTCTGTGTGGGCCAGG - Intergenic
1147179437 17:38674871-38674893 CCCTCCCCGCCGCCTGGGCCCGG - Exonic
1147769765 17:42859464-42859486 GCCTCCCCTCATCTGGGGCCTGG - Intergenic
1147959410 17:44157347-44157369 GCCTCCCTTCAGCATGGGCCTGG + Intronic
1148209616 17:45800333-45800355 GCCTCTCCTCATCTTCCGCCAGG - Intronic
1148615561 17:48997656-48997678 GCCTCTCCGCCTCTTGGCCTAGG + Exonic
1151459781 17:74247665-74247687 CCCCATCCTCCACTTGGGCCTGG + Intronic
1151490479 17:74430067-74430089 GCCTTTCCCCCGCCTGGGTCGGG + Intronic
1151554636 17:74840488-74840510 GCCGCTCCTGCTCCTGGGCCAGG - Intergenic
1151805264 17:76400982-76401004 CCATCTCCTACCCTTGGGCCCGG + Intronic
1152014981 17:77744641-77744663 GCCTCTGCTCCTCTCAGGCCTGG + Intergenic
1152105215 17:78324742-78324764 GCACCTCCTCCTCCTGGGCCCGG + Intergenic
1152246403 17:79186916-79186938 GCCTCTCCTCCAGTTGGGCAGGG + Intronic
1154067170 18:11118269-11118291 GCCTCTCCAACGCTGGGACCTGG + Intronic
1155461670 18:26090687-26090709 GCCGCCCGTCCGCTTGGCCCCGG - Intronic
1160928501 19:1558623-1558645 GCTTCCCCTCCTGTTGGGCCGGG - Intronic
1161300078 19:3538212-3538234 GCCCCTCCTCTGGCTGGGCCCGG - Intronic
1161315307 19:3614754-3614776 CCCTCCCCTCCGCTGTGGCCAGG - Intronic
1161330392 19:3684036-3684058 GCCTCTCCTGTGCTGGGGGCCGG - Intronic
1161474573 19:4477134-4477156 GCCTCTCCTTTGTTTCGGCCTGG + Intronic
1162220413 19:9171587-9171609 TACTCTCTTCCCCTTGGGCCCGG - Intergenic
1162568555 19:11457600-11457622 GTCTCTGCTCTGTTTGGGCCAGG + Intronic
1163233097 19:16016842-16016864 GTCTCTCCTCCAGCTGGGCCTGG - Intergenic
1164128126 19:22336994-22337016 GACTCTCCTCCTCTTCTGCCAGG - Intergenic
1166784514 19:45359582-45359604 GCCTCTACTCCTCTTGTCCCTGG + Intronic
1166808195 19:45499342-45499364 TTCACGCCTCCGCTTGGGCCTGG + Exonic
1167052138 19:47085738-47085760 GCCGCTCCTCCTCCTGGGTCGGG + Intronic
1167278301 19:48552114-48552136 GCTGCCCCTCCCCTTGGGCCGGG + Exonic
1167960776 19:53102964-53102986 GCCGCGCCTCCGCCTGGTCCTGG - Intronic
1168134161 19:54339095-54339117 GCATCTCCTCCTCCTGGCCCTGG + Exonic
1168325513 19:55536796-55536818 GCCCCTCCTCCGCCAGGCCCAGG + Intronic
929362447 2:41109790-41109812 GCCTCCTCTCAGCTTGTGCCTGG - Intergenic
929992383 2:46801102-46801124 GCCTCTCCCCGGCTAGGGCCTGG + Intergenic
934990127 2:98914829-98914851 GCCTCTCTTCCTCCTGTGCCCGG + Intronic
936489303 2:112956713-112956735 CACCCTCCTCCACTTGGGCCGGG - Intergenic
936845148 2:116821807-116821829 GCCCCTCCTCCCCTTGGGGTGGG - Intergenic
938401436 2:130995525-130995547 GCCTCTCCTCCACATGTGCCTGG + Intronic
938628892 2:133143335-133143357 GGCTCTCCACCTCTTAGGCCAGG + Intronic
938696227 2:133837693-133837715 GCCTCTCCTCTGCTCGGGGCTGG + Intergenic
939170447 2:138689322-138689344 CACTCTCCTCCTCTGGGGCCAGG - Intronic
939700643 2:145386679-145386701 GCCTCTCCACTGGTAGGGCCTGG - Intergenic
941906101 2:170716830-170716852 GCCTCTCCGGCGCCTGTGCCGGG + Exonic
947480108 2:230491511-230491533 GCTTCTCCTCTGCTGGAGCCAGG - Intronic
947592997 2:231395775-231395797 GCCCCTCCGCCGCTCCGGCCCGG + Exonic
1169167385 20:3435865-3435887 CCCTCTCCTCCAGTGGGGCCTGG + Intergenic
1170092775 20:12609579-12609601 GCTTCTTCTCCACTTGGGTCTGG + Intergenic
1170567909 20:17617066-17617088 GGCTCCCCTCCGGTTGGGCTTGG - Intronic
1172182762 20:33013698-33013720 GCCTGCCCTCCACTTGGCCCAGG - Intronic
1172930939 20:38586114-38586136 GCCTCTCCTTCTCTTGGCCGTGG - Exonic
1173505750 20:43585806-43585828 GCCTCCCCTTAGCTAGGGCCAGG + Intronic
1173792045 20:45834125-45834147 GCCCCTCCTCCTCCTGCGCCGGG + Intronic
1176099773 20:63359658-63359680 GCCGCTCCTCGGCGTGGGCCCGG + Exonic
1176106437 20:63391776-63391798 CCATTTCCTCCCCTTGGGCCCGG - Intergenic
1176428599 21:6563195-6563217 GCCCCTCCCTCGCCTGGGCCCGG + Intergenic
1177396053 21:20537883-20537905 GCCTCTTCTCTGCTTGGAGCTGG - Intergenic
1179704089 21:43171511-43171533 GCCCCTCCCTCGCCTGGGCCCGG + Intronic
1181014611 22:20061901-20061923 GCCTCCCCTGGGCCTGGGCCTGG - Intronic
1181082637 22:20424957-20424979 GCCTCTCCCCCGCTAGGGCCTGG - Exonic
1181488112 22:23244438-23244460 CCCTCTCCTCCGTTAGGTCCTGG + Intronic
1182034881 22:27190194-27190216 GCCTCTTCTCTGCCTTGGCCTGG + Intergenic
1182450655 22:30418641-30418663 GCCTCTGCTCCTCTTGGGAATGG - Intronic
1183380004 22:37485964-37485986 GGCTTTCCACCGCTTGCGCCTGG - Exonic
1183484985 22:38083867-38083889 GCCCCTCCTCCACTAGGACCAGG + Intronic
1183779468 22:39989521-39989543 GCCTCTCCTCCCAGTGGGCCTGG + Intergenic
1184500056 22:44865953-44865975 CCCTGTCCTCCCCCTGGGCCGGG - Intergenic
1185006448 22:48279443-48279465 GCGATTCCTCCGCCTGGGCCAGG - Intergenic
950560603 3:13719422-13719444 GCCTCTCCTCATCCTGGTCCTGG + Intergenic
953772146 3:45785936-45785958 GCCTCTCATCCTCTGGAGCCTGG - Intronic
953909484 3:46884470-46884492 GCACCTCCTCCTCCTGGGCCAGG + Intronic
954389840 3:50262905-50262927 GCCTGTCCTCTGCTGGGTCCTGG + Intergenic
954874634 3:53793633-53793655 GAGTCTTCTCCACTTGGGCCTGG + Intronic
955589917 3:60524112-60524134 GCATCTCCTCTGCCTGGGCAGGG - Intronic
968234062 3:197021464-197021486 GCTTCTCCTCCGCAGGTGCCTGG - Exonic
968288222 3:197520442-197520464 GCCTCCCCTCTGTGTGGGCCGGG + Intronic
969254074 4:5990722-5990744 GTCACTCCTCCGCATGGACCTGG - Intergenic
969349558 4:6590636-6590658 GCCTCTATCCCGCCTGGGCCTGG + Intronic
972235529 4:37129505-37129527 GCTTCTCCAGCTCTTGGGCCAGG - Intergenic
973981864 4:56314477-56314499 GCCTCTCCTCCGCTTGGGCCTGG - Exonic
977065089 4:92304351-92304373 GCCTCTACTGCTCTTGGGCAGGG - Intergenic
979977442 4:127214219-127214241 TCCTCTCCTCCTCTTTTGCCAGG - Intergenic
980133221 4:128835716-128835738 GCCTCTCCTTCACTTGGACATGG - Intronic
980219308 4:129895127-129895149 GCATCCCCTCCCCTTAGGCCAGG - Intergenic
981694113 4:147542187-147542209 GGCTCTCCACAGCTTGGGGCAGG - Intronic
985889569 5:2705230-2705252 GCCTCTCCCCAGCCTGGCCCAGG - Intergenic
990762763 5:59148957-59148979 GCTTGTGCTCAGCTTGGGCCTGG + Intronic
992732836 5:79689884-79689906 GCCTCTCCCGGGCCTGGGCCGGG - Exonic
992942439 5:81775294-81775316 TCCTCTCCTCAGCTCAGGCCAGG - Intergenic
994670276 5:102755188-102755210 CCCTCTCCTCGGCGTGCGCCGGG - Intronic
997617750 5:135263520-135263542 CGCTCTCCTCCGCGTGGGCTTGG + Intronic
997660465 5:135585409-135585431 GCCTCTCCTACCCTGGGGCTAGG - Intergenic
1002462187 5:179379687-179379709 GCCTCACCTCGGCTTGAGCATGG + Intergenic
1002526994 5:179820565-179820587 GCCCCTCCCAGGCTTGGGCCTGG - Intronic
1002833276 6:843648-843670 GCCTTTCCTCTGCGTGTGCCTGG + Intergenic
1003974848 6:11332774-11332796 ACCTCTGCTCCACTTGTGCCTGG - Intronic
1005946649 6:30600757-30600779 GCTTCTCATCAACTTGGGCCCGG - Exonic
1006137184 6:31902172-31902194 GCCTTGCCTCCTCTTTGGCCGGG + Intronic
1006313647 6:33278085-33278107 GCCTCTTCTGTACTTGGGCCGGG + Exonic
1006353259 6:33537039-33537061 GCCTCTCCTCCCCATGTGCTGGG + Intergenic
1007401357 6:41604353-41604375 GCCTCTCCTGCTCTGGGACCTGG + Intergenic
1007563446 6:42829801-42829823 GCCTCTCCTCAGCTTGTGGGTGG + Exonic
1008068942 6:47079844-47079866 GCCTCTCCTCCTCATGGCTCTGG + Intergenic
1013473493 6:110486845-110486867 CCCTGTCCTCCCCTTGGCCCAGG + Intergenic
1016099888 6:140086083-140086105 GCTCCTCCTCCCCTTGGGCAGGG + Intergenic
1018848176 6:167569665-167569687 GCTTCTCCTAGGCTTGGGCTGGG - Intergenic
1019295319 7:270768-270790 GCCTCTCCTGCCCTCTGGCCTGG + Intergenic
1021394715 7:20133068-20133090 GCCTCTGGTCCTCTTAGGCCAGG + Intergenic
1034255503 7:149722622-149722644 GCTGCTCCGCCGCCTGGGCCTGG + Intronic
1035022687 7:155808624-155808646 GCCTCTCCTCCGCCCGCGCTGGG + Intronic
1036386345 8:8285117-8285139 GCTTCTCCCCCGCTGGAGCCTGG + Intergenic
1037703331 8:21295269-21295291 GCCCCTCCCCACCTTGGGCCAGG - Intergenic
1038433469 8:27518546-27518568 GTCTCTCCTCCCCTTGGCCTTGG - Intronic
1039991650 8:42493091-42493113 GTCTCTCCTAAGCCTGGGCCTGG - Intronic
1042120680 8:65484983-65485005 GTCTCTTCTCCTCTTGGTCCAGG + Intergenic
1045713565 8:105015037-105015059 GCCTCTCCTCCCTTTGGCCCTGG - Intronic
1049062871 8:140289828-140289850 GCCTCTCCTCCTGTTGGGCGAGG - Intronic
1049201462 8:141342610-141342632 GCCTGTCTTCCCCTTGGGACTGG + Intergenic
1049605152 8:143525924-143525946 GCCTGCCGTCCGCCTGGGCCTGG + Intronic
1049625486 8:143617836-143617858 GCCTCGCCGGCGCTGGGGCCAGG + Intronic
1055514728 9:77023210-77023232 GCGGCGCCTCCGCTGGGGCCTGG + Intergenic
1056386189 9:86099277-86099299 GCCTCCCCGCGGCTTGCGCCGGG - Intronic
1056775941 9:89512626-89512648 GCTTCTCCTTCCCCTGGGCCGGG + Intergenic
1059269085 9:113061022-113061044 GCTTCTCCACCGTTTGTGCCTGG + Intergenic
1059270221 9:113066471-113066493 GCTTCTCCACCGTTTGTGCCTGG + Intergenic
1059271357 9:113071921-113071943 GCTTCTCCACCGTTTGTGCCTGG + Intergenic
1059272488 9:113077365-113077387 GCTTCTCCACCGTTTGTGCCTGG + Intergenic
1059273623 9:113082807-113082829 GCTTCTCCACCGTTTGTGCCTGG + Intergenic
1059274759 9:113088253-113088275 GCTTCTCCACCGTTTGTGCCTGG + Intergenic
1061207640 9:129174000-129174022 GCCCCTCCTCGACGTGGGCCTGG + Intergenic
1061709215 9:132476199-132476221 GTCTATCCTCTGCTTGGTCCTGG + Intronic
1061862234 9:133473929-133473951 CCCACTCCTCCGCATGGGTCAGG - Intronic
1062402795 9:136379775-136379797 GCCTCTTCCCCGCCAGGGCCAGG + Intronic
1062606861 9:137352365-137352387 GCCTCTCCTCCCAGTGGCCCTGG + Intronic
1185912606 X:3999174-3999196 GCTTCTCCTCCTCTCAGGCCTGG - Intergenic
1190297896 X:49039250-49039272 GCCTCTCCTGCTCCTGCGCCTGG + Exonic
1192212456 X:69136661-69136683 GGCCCTCCACCGCCTGGGCCTGG - Intergenic
1192363340 X:70452671-70452693 GCTCCGCCTCCGCTTCGGCCTGG + Intronic
1192810372 X:74541977-74541999 ACCTCTGCTCAGCTTTGGCCAGG + Intergenic
1195894575 X:109732944-109732966 CGCTCGCCTCCGCTGGGGCCGGG - Intronic