ID: 973981864

View in Genome Browser
Species Human (GRCh38)
Location 4:56314477-56314499
Sequence GCCTCTCCTCCGCTTGGGCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 213}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973981864_973981874 7 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981874 4:56314507-56314529 GGAGGAGGACGCCAGGCTGGAGG 0: 1
1: 0
2: 5
3: 76
4: 625
973981864_973981871 -8 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981871 4:56314492-56314514 GGAGAGGCGGCGGCTGGAGGAGG 0: 1
1: 1
2: 16
3: 114
4: 1254
973981864_973981881 28 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981881 4:56314528-56314550 GGAGCGGAGGCGGCAGGAGGAGG 0: 1
1: 0
2: 17
3: 164
4: 1594
973981864_973981872 0 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981872 4:56314500-56314522 GGCGGCTGGAGGAGGACGCCAGG 0: 1
1: 1
2: 4
3: 42
4: 446
973981864_973981875 12 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981875 4:56314512-56314534 AGGACGCCAGGCTGGAGGAGCGG 0: 1
1: 0
2: 6
3: 37
4: 760
973981864_973981873 4 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981873 4:56314504-56314526 GCTGGAGGAGGACGCCAGGCTGG 0: 1
1: 0
2: 6
3: 57
4: 487
973981864_973981879 22 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981879 4:56314522-56314544 GCTGGAGGAGCGGAGGCGGCAGG 0: 1
1: 1
2: 8
3: 99
4: 797
973981864_973981878 18 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981878 4:56314518-56314540 CCAGGCTGGAGGAGCGGAGGCGG 0: 1
1: 0
2: 4
3: 91
4: 790
973981864_973981876 15 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981876 4:56314515-56314537 ACGCCAGGCTGGAGGAGCGGAGG 0: 1
1: 0
2: 5
3: 24
4: 346
973981864_973981880 25 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981880 4:56314525-56314547 GGAGGAGCGGAGGCGGCAGGAGG 0: 1
1: 0
2: 21
3: 181
4: 1401

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973981864 Original CRISPR GCCTCTCCTCCGCTTGGGCC TGG (reversed) Exonic