ID: 973981870 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:56314489-56314511 |
| Sequence | GGAGGAGAGGCGGCGGCTGG AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 1271 | |||
| Summary | {0: 1, 1: 0, 2: 18, 3: 140, 4: 1112} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 973981862_973981870 | -10 | Left | 973981862 | 4:56314476-56314498 | CCCAGGCCCAAGCGGAGGAGAGG | 0: 1 1: 0 2: 0 3: 20 4: 269 |
||
| Right | 973981870 | 4:56314489-56314511 | GGAGGAGAGGCGGCGGCTGGAGG | 0: 1 1: 0 2: 18 3: 140 4: 1112 |
||||
| 973981856_973981870 | 25 | Left | 973981856 | 4:56314441-56314463 | CCTGGAGGCGGAGGAGGAGCGAA | 0: 1 1: 0 2: 2 3: 49 4: 556 |
||
| Right | 973981870 | 4:56314489-56314511 | GGAGGAGAGGCGGCGGCTGGAGG | 0: 1 1: 0 2: 18 3: 140 4: 1112 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 973981870 | Original CRISPR | GGAGGAGAGGCGGCGGCTGG AGG | Exonic | ||