ID: 973981871

View in Genome Browser
Species Human (GRCh38)
Location 4:56314492-56314514
Sequence GGAGAGGCGGCGGCTGGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1386
Summary {0: 1, 1: 1, 2: 16, 3: 114, 4: 1254}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973981862_973981871 -7 Left 973981862 4:56314476-56314498 CCCAGGCCCAAGCGGAGGAGAGG 0: 1
1: 0
2: 0
3: 20
4: 269
Right 973981871 4:56314492-56314514 GGAGAGGCGGCGGCTGGAGGAGG 0: 1
1: 1
2: 16
3: 114
4: 1254
973981856_973981871 28 Left 973981856 4:56314441-56314463 CCTGGAGGCGGAGGAGGAGCGAA 0: 1
1: 0
2: 2
3: 49
4: 556
Right 973981871 4:56314492-56314514 GGAGAGGCGGCGGCTGGAGGAGG 0: 1
1: 1
2: 16
3: 114
4: 1254
973981864_973981871 -8 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981871 4:56314492-56314514 GGAGAGGCGGCGGCTGGAGGAGG 0: 1
1: 1
2: 16
3: 114
4: 1254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973981871 Original CRISPR GGAGAGGCGGCGGCTGGAGG AGG Exonic