ID: 973981871 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:56314492-56314514 |
| Sequence | GGAGAGGCGGCGGCTGGAGG AGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 1386 | |||
| Summary | {0: 1, 1: 1, 2: 16, 3: 114, 4: 1254} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 973981862_973981871 | -7 | Left | 973981862 | 4:56314476-56314498 | CCCAGGCCCAAGCGGAGGAGAGG | 0: 1 1: 0 2: 0 3: 20 4: 269 |
||
| Right | 973981871 | 4:56314492-56314514 | GGAGAGGCGGCGGCTGGAGGAGG | 0: 1 1: 1 2: 16 3: 114 4: 1254 |
||||
| 973981864_973981871 | -8 | Left | 973981864 | 4:56314477-56314499 | CCAGGCCCAAGCGGAGGAGAGGC | 0: 1 1: 0 2: 1 3: 15 4: 213 |
||
| Right | 973981871 | 4:56314492-56314514 | GGAGAGGCGGCGGCTGGAGGAGG | 0: 1 1: 1 2: 16 3: 114 4: 1254 |
||||
| 973981856_973981871 | 28 | Left | 973981856 | 4:56314441-56314463 | CCTGGAGGCGGAGGAGGAGCGAA | 0: 1 1: 0 2: 2 3: 49 4: 556 |
||
| Right | 973981871 | 4:56314492-56314514 | GGAGAGGCGGCGGCTGGAGGAGG | 0: 1 1: 1 2: 16 3: 114 4: 1254 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 973981871 | Original CRISPR | GGAGAGGCGGCGGCTGGAGG AGG | Exonic | ||