ID: 973981875

View in Genome Browser
Species Human (GRCh38)
Location 4:56314512-56314534
Sequence AGGACGCCAGGCTGGAGGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 804
Summary {0: 1, 1: 0, 2: 6, 3: 37, 4: 760}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973981868_973981875 6 Left 973981868 4:56314483-56314505 CCAAGCGGAGGAGAGGCGGCGGC 0: 1
1: 0
2: 1
3: 25
4: 214
Right 973981875 4:56314512-56314534 AGGACGCCAGGCTGGAGGAGCGG 0: 1
1: 0
2: 6
3: 37
4: 760
973981866_973981875 7 Left 973981866 4:56314482-56314504 CCCAAGCGGAGGAGAGGCGGCGG 0: 1
1: 0
2: 0
3: 11
4: 135
Right 973981875 4:56314512-56314534 AGGACGCCAGGCTGGAGGAGCGG 0: 1
1: 0
2: 6
3: 37
4: 760
973981864_973981875 12 Left 973981864 4:56314477-56314499 CCAGGCCCAAGCGGAGGAGAGGC 0: 1
1: 0
2: 1
3: 15
4: 213
Right 973981875 4:56314512-56314534 AGGACGCCAGGCTGGAGGAGCGG 0: 1
1: 0
2: 6
3: 37
4: 760
973981862_973981875 13 Left 973981862 4:56314476-56314498 CCCAGGCCCAAGCGGAGGAGAGG 0: 1
1: 0
2: 0
3: 20
4: 269
Right 973981875 4:56314512-56314534 AGGACGCCAGGCTGGAGGAGCGG 0: 1
1: 0
2: 6
3: 37
4: 760

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973981875 Original CRISPR AGGACGCCAGGCTGGAGGAG CGG Exonic