ID: 973982006

View in Genome Browser
Species Human (GRCh38)
Location 4:56315050-56315072
Sequence ACCGCAGCTCCTCCACCTTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973982006_973982013 28 Left 973982006 4:56315050-56315072 CCGCAAGGTGGAGGAGCTGCGGT 0: 1
1: 0
2: 0
3: 10
4: 136
Right 973982013 4:56315101-56315123 GCCCCGGCCCTACACGTTCCAGG 0: 1
1: 0
2: 0
3: 9
4: 138
973982006_973982011 12 Left 973982006 4:56315050-56315072 CCGCAAGGTGGAGGAGCTGCGGT 0: 1
1: 0
2: 0
3: 10
4: 136
Right 973982011 4:56315085-56315107 ACGAGAGACAGACCATGCCCCGG 0: 1
1: 0
2: 2
3: 12
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973982006 Original CRISPR ACCGCAGCTCCTCCACCTTG CGG (reversed) Exonic
900298500 1:1964887-1964909 ACCGGAGCTCCTCCACTTCCAGG - Exonic
900341927 1:2193700-2193722 ACGGCTGCTGCTCCACCCTGGGG + Exonic
904741107 1:32676533-32676555 ACCGCAACTCCTCCGCCTCCTGG - Intronic
906231780 1:44170656-44170678 AGCTCAGCTCCTCCCCCTAGAGG - Intergenic
910113205 1:83703587-83703609 ACCTCAGATCCTCAACCTTAAGG - Intergenic
914490868 1:148149443-148149465 ACAGCGGCTCCACCGCCTTGGGG - Intronic
921389665 1:214605775-214605797 ACAGCGGCTCCACCGCCTTGGGG + Intronic
922481954 1:225945266-225945288 TCCCCAGCTCCTCCACCTAAGGG - Intergenic
1065844644 10:29735271-29735293 ACCGCAGCTCCGGCCACTTGCGG + Intronic
1067574984 10:47403477-47403499 ACCCCAACTCTTCCATCTTGGGG - Intergenic
1070594216 10:77821162-77821184 GCCCCAGCTCATCCACCTTCTGG + Exonic
1071353386 10:84768621-84768643 GCCACAGCTCCTCCAGCTTAGGG - Intergenic
1071598312 10:86943598-86943620 ACTGCAACTCCTCCTCCCTGCGG + Exonic
1073513067 10:104054541-104054563 AAGTCAGCTCCTCCACTTTGGGG - Intronic
1075541578 10:123318468-123318490 ACAGCAGCTCATCCTCCTTGTGG + Intergenic
1076020115 10:127065681-127065703 TCCGCAGCTCCTCCAGCTCCAGG + Intronic
1076425190 10:130362746-130362768 ACAGCAGGTCCTCCGCCTTCAGG + Intergenic
1077541855 11:3150417-3150439 CCAGCAGCTCCTCCTCCTTAGGG + Intronic
1078422311 11:11222786-11222808 ACTGCAACCCCTCCACCTTCTGG + Intergenic
1083922496 11:65788148-65788170 AACGCACTTCCTTCACCTTGCGG + Intronic
1084706759 11:70820293-70820315 GTCCCAGCTCCTCCAACTTGGGG - Intronic
1084860369 11:72014124-72014146 CCCGCAGTGCCTCCAGCTTGGGG + Exonic
1085736471 11:79043438-79043460 ACAGAAGCTCCACCATCTTGTGG - Intronic
1090456220 11:126851901-126851923 ACCGTGGCTCCTCTACCTCGAGG + Intronic
1096634273 12:52948813-52948835 CCAGCACCTCCTCCACCTGGGGG + Intronic
1102612896 12:114128258-114128280 AACGAAGCTCCTCCACCATGGGG - Intergenic
1104407846 12:128533309-128533331 ACAGCAGCTCCTCCTCCTGAGGG + Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1106001414 13:25726932-25726954 ACTGCACCTCCTTCTCCTTGGGG - Intronic
1106296805 13:28421510-28421532 GCAGCAGCTCCTCCACCATTGGG - Intronic
1107052615 13:36067693-36067715 ACCTCAGCTCTACCTCCTTGAGG + Intronic
1108563964 13:51676041-51676063 CCCTCAGATCCTCCACCCTGTGG - Intronic
1110558336 13:76885486-76885508 ACCGCGGCTCCTACACCATCGGG - Exonic
1112926362 13:104679814-104679836 TCTGCAGCTCCTCCACCTGCAGG - Intergenic
1114317717 14:21523530-21523552 TGAGCAGCTCCTCCACCTTCAGG + Exonic
1116998847 14:51352068-51352090 TCCGCAGCTTCTTCATCTTGCGG + Intergenic
1119197176 14:72725612-72725634 ACCCCATCTCCTCTTCCTTGTGG + Intronic
1121858027 14:97288454-97288476 ACAGAGGCTTCTCCACCTTGGGG + Intergenic
1122857079 14:104565137-104565159 CCCGCAGCACCACCACCCTGTGG + Intronic
1125669177 15:41457456-41457478 ATCTCAGCTCCTCCACCTCCCGG - Intronic
1125729216 15:41883347-41883369 CCTGCAGCTCCTCCAGCTGGTGG + Exonic
1126102902 15:45130180-45130202 GCCGCAGCTCCTCCACGTTATGG + Intronic
1127416298 15:58760584-58760606 AACGCTGCGCCTCCTCCTTGTGG + Intergenic
1129226734 15:74174587-74174609 ACCCCAGCTCCTCCTCCGAGTGG - Intronic
1131428151 15:92364101-92364123 CTCTCAGCTCCTCCACCTTCGGG - Intergenic
1136298547 16:29317736-29317758 GCCGCTGCTTCTCCACCTGGTGG + Intergenic
1136497457 16:30652961-30652983 ACCGGACCTCTTCCACCCTGAGG + Exonic
1137748675 16:50842140-50842162 ACCGCAGCTTCCCCACCTCCAGG - Intergenic
1138410207 16:56833440-56833462 ACCACAGCACGTCCCCCTTGGGG + Intronic
1140124830 16:72110472-72110494 TCCACTGCTCCTCCATCTTGAGG + Intronic
1142803904 17:2361761-2361783 GCTGCAGCTCCTGTACCTTGTGG - Exonic
1143164682 17:4891974-4891996 ACCGCAGCTCCACCATCATCCGG + Intronic
1143180372 17:4980667-4980689 TCCGCACCTTCTCTACCTTGAGG + Intronic
1144339064 17:14297804-14297826 TCCGCAGCTGCTCCAGCCTGCGG - Intergenic
1145018798 17:19414787-19414809 GCAGCAGCTCCTGCACCTTGGGG - Exonic
1145191489 17:20844138-20844160 ACAGCGGCTCCACCGCCTTGGGG - Intronic
1146626661 17:34440185-34440207 ACTGCAGATCCACCACCCTGAGG + Intergenic
1146689797 17:34865473-34865495 CCTGCGGCTCCTCCACCCTGGGG + Intergenic
1148440878 17:47711107-47711129 ACCCCAGTTCCTCCATCCTGTGG + Exonic
1149595230 17:57861401-57861423 ACCGCTGCACCTCAACCTTGCGG - Exonic
1150131566 17:62671993-62672015 TCCACAGCTCCTCCACCTCTGGG - Exonic
1152855637 17:82663514-82663536 CCCCCAGCACCCCCACCTTGGGG - Intronic
1155654645 18:28178209-28178231 CCCGCAGCCCCTCCACCTGCCGG - Intergenic
1157667379 18:49499203-49499225 CCCGCAGCTGCCCCACGTTGGGG + Intergenic
1158437094 18:57441421-57441443 ACCGCAGCTCCTCCCCCGCGAGG + Intronic
1160994718 19:1877301-1877323 ACAGCGGCTCCACCGCCTTGGGG + Exonic
1161435872 19:4262531-4262553 ACCCTAACTCCTCCACCCTGTGG + Intronic
1161794894 19:6380929-6380951 GCAGCACCTCCTCCACCCTGCGG - Exonic
1162194304 19:8972488-8972510 ACTACAGCTCCCCCAACTTGGGG - Exonic
1163463866 19:17455175-17455197 ACCCCAACTCCTCCACCCTAGGG + Intronic
1164767333 19:30781935-30781957 AGGGCACCTCCTGCACCTTGAGG - Intergenic
1166093001 19:40522425-40522447 ACTGCACCTCCTCCGCCTTCTGG + Intronic
1166729348 19:45049952-45049974 ACCCCAGCTCCTTCACTCTGTGG - Intronic
1166817243 19:45553705-45553727 CACGCTGCTCCTCCTCCTTGTGG + Intronic
1166981987 19:46636279-46636301 CCCGCCGCCCCGCCACCTTGGGG + Intergenic
1167078032 19:47260735-47260757 CCCCCAGCTCCTCCTCCTCGAGG - Exonic
1167568622 19:50272696-50272718 CCTGCAGCTCCTCCTCCTTCCGG - Exonic
1168688292 19:58361872-58361894 ACCGCTGCCCCTCCATCCTGTGG + Intronic
927597572 2:24410115-24410137 AGAGCAGCTGCTCCATCTTGTGG - Intergenic
929813338 2:45210915-45210937 ACAGCACTTCCTCCTCCTTGTGG + Intergenic
932355913 2:71068454-71068476 ACCGCAGTCGCTCCACCTGGAGG + Exonic
933220638 2:79683738-79683760 CCTGCAGCTCCTGCAACTTGTGG - Intronic
948134759 2:235628291-235628313 CCAGCAGCTCCTCCACCAAGTGG - Intronic
1173644355 20:44624300-44624322 TACACAGCTCCACCACCTTGGGG + Exonic
1174112908 20:48208417-48208439 CCCACAGCTCCTGCACCTTGTGG - Intergenic
1175502517 20:59460524-59460546 GCAGCAGCTCCTCCAGCCTGAGG + Intergenic
1176166519 20:63677030-63677052 ACCTCAGTTGCTGCACCTTGAGG + Intronic
1176987614 21:15455888-15455910 AGCGCACCTCCTCCACCAAGAGG - Intergenic
1180950557 22:19718764-19718786 ACAGCAGCTGCTCCACCAGGCGG - Intronic
1181120806 22:20667919-20667941 ACAGCGGCTCCACCGCCTTGGGG + Intergenic
1181333768 22:22114945-22114967 ACAGCGGCTCCACCGCCTTGGGG + Intergenic
1181684859 22:24521406-24521428 ACCGCGGCTCTTCCACCTCCCGG - Intronic
1181877026 22:25947705-25947727 ACAGCTGCTCATCCACCTGGGGG - Exonic
1185066619 22:48635474-48635496 GCAGCAGCTCCTCCTCCGTGAGG + Intronic
952342565 3:32458152-32458174 TCCGCAGCTGCTCCTCCCTGGGG - Intronic
952392195 3:32890398-32890420 GCCGCAGCTTCTCCACCTGCAGG - Exonic
956746870 3:72317404-72317426 CCAGCAGATCCTCCACCTGGTGG + Intergenic
962325558 3:134429079-134429101 ACAGCAGCCCCTCCAGCATGAGG + Intergenic
964356918 3:155859455-155859477 ACTGCACCTCCTCCACCTTCTGG + Intergenic
965596890 3:170419189-170419211 AGCCCAGCTCATCCAGCTTGCGG - Exonic
967862334 3:194161407-194161429 GGCGCAGCTCCTTCACCTGGGGG - Intergenic
967953924 3:194862712-194862734 TCCCCAGCTCCTCCAAGTTGGGG + Intergenic
970285388 4:14507658-14507680 ACAGCAGGTCCTGAACCTTGAGG - Intergenic
970609093 4:17709119-17709141 CCTGCAGCTCCTCGGCCTTGCGG + Exonic
972841401 4:42933875-42933897 ACATCAGCTCCTCCTTCTTGGGG - Intronic
973982006 4:56315050-56315072 ACCGCAGCTCCTCCACCTTGCGG - Exonic
976591736 4:86855838-86855860 ACGGCACCTGCTCCACCTTCAGG + Intergenic
981023426 4:140052285-140052307 CCCGCAGTGGCTCCACCTTGTGG - Intronic
981278031 4:142924347-142924369 AGTTCAGCTCTTCCACCTTGAGG - Intergenic
985786486 5:1898007-1898029 CGGGCAGCTCCTTCACCTTGTGG - Intergenic
992615194 5:78540741-78540763 ACAACAGCTCCTCCTCCTTGGGG + Intronic
1001435760 5:171698108-171698130 TCCCCAGCTCCTCCTCCTTCAGG - Intergenic
1001436450 5:171703145-171703167 ACCGCAGCTGATCCACCTCTGGG - Intergenic
1006122690 6:31816785-31816807 GCAGCAGCTTCTGCACCTTGGGG - Exonic
1006124553 6:31828979-31829001 GCAGCAGCTTCTGCACCTTGGGG - Exonic
1006735389 6:36269465-36269487 TCCCCAGCTGCTCCTCCTTGGGG + Intronic
1007087575 6:39159856-39159878 ACTGCAGCACTCCCACCTTGTGG - Intergenic
1007425667 6:41744431-41744453 ACACCGGCTCCTCCAACTTGTGG - Exonic
1007469847 6:42082411-42082433 ACTGCAACTCCTCCACCTCCCGG + Exonic
1007507103 6:42344078-42344100 AACGCAGCTCCTTCTCCTTCAGG - Intronic
1007917968 6:45578624-45578646 AAAGCAGCTCCTCCACATGGAGG - Intronic
1008117527 6:47569285-47569307 AACGCATTTCCTCCACCTTCTGG - Intronic
1008385068 6:50879961-50879983 CCCCCAGCCCCTCCACCTTCAGG + Intergenic
1010727926 6:79356246-79356268 AGAGCAGCTCCTCCACTCTGCGG - Intergenic
1017232722 6:152090604-152090626 AGCACAGCTCCTCCAGCTTCCGG + Intronic
1017645068 6:156532768-156532790 ACAGCAGCGCCTGCACCTTGAGG - Intergenic
1020987582 7:15155983-15156005 ACAGCAGGTGCTTCACCTTGAGG - Intergenic
1031609372 7:123806996-123807018 ACCCCAGCTCCTGGACCTTTTGG + Intergenic
1031741082 7:125431518-125431540 ACTCAAGCTCCTCCATCTTGTGG - Intergenic
1033230557 7:139594122-139594144 ACCGCACCTCCTCTACTGTGTGG + Intronic
1034429367 7:151033619-151033641 ACCGCAGCTCCTCCCTCCTCCGG + Exonic
1034445966 7:151114625-151114647 CCCTCAACTCCTCCACCTCGCGG - Intronic
1034575714 7:151995145-151995167 ACCTCAGCTCCTGCAACCTGTGG - Intronic
1034671512 7:152862306-152862328 ACTGCTGCCCCTCCACCTCGTGG - Intergenic
1042508922 8:69591047-69591069 ACCCCTTCTCCTCCAGCTTGAGG - Intronic
1042524824 8:69753263-69753285 ACCGCAGCTCCTGCCCCTCTTGG - Intronic
1048399107 8:134047077-134047099 TCCTCATCTCCTTCACCTTGAGG - Intergenic
1049510945 8:143026378-143026400 ACCGCAGCCCCTCCTCCCTCCGG - Intergenic
1052387103 9:27835387-27835409 AGCGCAGCCCCTCCACCAAGGGG - Intergenic
1060113712 9:120925014-120925036 ACCTCTGCTCCTCCACCTCCTGG + Intronic
1060978731 9:127780348-127780370 ACAGCAGCTCCCCCTCCATGGGG + Intergenic
1061193927 9:129097285-129097307 TCCGCAGCAGCTCCACCTTCTGG + Exonic
1062568836 9:137175236-137175258 CCAGCAGCTCCTCCTCCTTCTGG + Exonic
1187271939 X:17787857-17787879 GCAGCAGCACCTCCACCTGGAGG - Intergenic
1191110279 X:56798929-56798951 AACCCTGCTCCTCCACCCTGAGG - Intergenic
1199762857 X:150918471-150918493 GAGGCAGCTCCTCCATCTTGAGG - Intergenic
1200267853 X:154655436-154655458 ACCGCAGCAGCTCCAGCTGGAGG - Intergenic