ID: 973983128

View in Genome Browser
Species Human (GRCh38)
Location 4:56323448-56323470
Sequence AGTGCTAACGTTATCCACAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 64
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 57}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973983128_973983133 0 Left 973983128 4:56323448-56323470 CCGCTGTGGATAACGTTAGCACT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 973983133 4:56323471-56323493 GCAAAAGCAAAAGGGGTTTCGGG 0: 1
1: 0
2: 1
3: 19
4: 247
973983128_973983137 21 Left 973983128 4:56323448-56323470 CCGCTGTGGATAACGTTAGCACT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 973983137 4:56323492-56323514 GGAGCAGCAGGCGACGCGGGAGG 0: 1
1: 0
2: 3
3: 37
4: 287
973983128_973983130 -8 Left 973983128 4:56323448-56323470 CCGCTGTGGATAACGTTAGCACT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 973983130 4:56323463-56323485 TTAGCACTGCAAAAGCAAAAGGG 0: 1
1: 0
2: 2
3: 31
4: 265
973983128_973983131 -7 Left 973983128 4:56323448-56323470 CCGCTGTGGATAACGTTAGCACT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 973983131 4:56323464-56323486 TAGCACTGCAAAAGCAAAAGGGG 0: 1
1: 0
2: 1
3: 24
4: 237
973983128_973983134 9 Left 973983128 4:56323448-56323470 CCGCTGTGGATAACGTTAGCACT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 973983134 4:56323480-56323502 AAAGGGGTTTCGGGAGCAGCAGG 0: 1
1: 0
2: 0
3: 12
4: 174
973983128_973983135 17 Left 973983128 4:56323448-56323470 CCGCTGTGGATAACGTTAGCACT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 973983135 4:56323488-56323510 TTCGGGAGCAGCAGGCGACGCGG 0: 1
1: 0
2: 0
3: 3
4: 86
973983128_973983136 18 Left 973983128 4:56323448-56323470 CCGCTGTGGATAACGTTAGCACT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 973983136 4:56323489-56323511 TCGGGAGCAGCAGGCGACGCGGG 0: 1
1: 0
2: 0
3: 6
4: 135
973983128_973983132 -1 Left 973983128 4:56323448-56323470 CCGCTGTGGATAACGTTAGCACT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 973983132 4:56323470-56323492 TGCAAAAGCAAAAGGGGTTTCGG 0: 1
1: 0
2: 2
3: 36
4: 427
973983128_973983129 -9 Left 973983128 4:56323448-56323470 CCGCTGTGGATAACGTTAGCACT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 973983129 4:56323462-56323484 GTTAGCACTGCAAAAGCAAAAGG 0: 1
1: 0
2: 4
3: 18
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973983128 Original CRISPR AGTGCTAACGTTATCCACAG CGG (reversed) Exonic