ID: 973983137

View in Genome Browser
Species Human (GRCh38)
Location 4:56323492-56323514
Sequence GGAGCAGCAGGCGACGCGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 287}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973983128_973983137 21 Left 973983128 4:56323448-56323470 CCGCTGTGGATAACGTTAGCACT 0: 1
1: 0
2: 0
3: 6
4: 57
Right 973983137 4:56323492-56323514 GGAGCAGCAGGCGACGCGGGAGG 0: 1
1: 0
2: 3
3: 37
4: 287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973983137 Original CRISPR GGAGCAGCAGGCGACGCGGG AGG Exonic