ID: 973983363

View in Genome Browser
Species Human (GRCh38)
Location 4:56325674-56325696
Sequence CCTTCAAGTGATTGGTAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973983363_973983367 -4 Left 973983363 4:56325674-56325696 CCTTATTACCAATCACTTGAAGG 0: 1
1: 0
2: 0
3: 9
4: 89
Right 973983367 4:56325693-56325715 AAGGATGGATGACTCTGAACAGG 0: 1
1: 0
2: 0
3: 14
4: 166
973983363_973983369 19 Left 973983363 4:56325674-56325696 CCTTATTACCAATCACTTGAAGG 0: 1
1: 0
2: 0
3: 9
4: 89
Right 973983369 4:56325716-56325738 CTCCCTACCAGTGATTAATAGGG 0: 1
1: 0
2: 0
3: 3
4: 55
973983363_973983368 18 Left 973983363 4:56325674-56325696 CCTTATTACCAATCACTTGAAGG 0: 1
1: 0
2: 0
3: 9
4: 89
Right 973983368 4:56325715-56325737 GCTCCCTACCAGTGATTAATAGG 0: 1
1: 0
2: 0
3: 8
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973983363 Original CRISPR CCTTCAAGTGATTGGTAATA AGG (reversed) Intronic
910823341 1:91375792-91375814 CCTTAAAGTGCTTTGTAATTGGG - Intronic
910893158 1:92039188-92039210 ACTTCATGTTATGGGTAATAGGG + Intronic
917219648 1:172715214-172715236 CATTCAGGTGATTGGTAGAAAGG - Intergenic
919091737 1:192985688-192985710 CCTTCAAGTCTTTGCTAATAAGG - Intergenic
919698052 1:200599538-200599560 ATTTCAAGTGATTGGTAGTGGGG - Intronic
920537703 1:206750175-206750197 CCTTTAAGTCATTGGTAATTGGG - Intergenic
920740045 1:208572350-208572372 ACTTCAAGTGTTTGACAATAGGG + Intergenic
921542523 1:216433648-216433670 GATTGAAGTTATTGGTAATAAGG + Intergenic
923274009 1:232380978-232381000 CCTTCAAGTAGTGGGTAAGAAGG + Intergenic
924319093 1:242829268-242829290 ACTTCTACTGATTGGTAATGGGG - Intergenic
1065062946 10:21926420-21926442 CCTTCCAGGAATTGGTAATTTGG - Intronic
1066521927 10:36230199-36230221 ACTTCAAGTAATTGTTGATAGGG - Intergenic
1068526323 10:58134363-58134385 CTTTCAGGTGATTGATTATAAGG - Intergenic
1072456215 10:95578707-95578729 GCTTCATGTGTTTGGTAATGAGG - Intergenic
1079815444 11:25050871-25050893 CCTTCAAATGATAGGAAATATGG + Intronic
1080084626 11:28264527-28264549 CCTTAAATTGATTGATAATCAGG - Intronic
1080596602 11:33778747-33778769 ACTGCCAGTGATTGGTAAAAAGG + Intergenic
1085064506 11:73481706-73481728 ACTACATGTGATAGGTAATATGG - Intronic
1085965383 11:81517000-81517022 CGTTCTATTAATTGGTAATATGG - Intergenic
1087329352 11:96760289-96760311 CCTTCAAGTAATTTTTAATTTGG - Intergenic
1089916672 11:122163864-122163886 TCTTCCAGTGATGGGTAAAAGGG - Intergenic
1090634163 11:128679041-128679063 CTTCAAAGTGATTGGTAATGTGG - Intergenic
1104094650 12:125545928-125545950 CCTTCAGGAGATTGGGAAAAGGG + Intronic
1108304763 13:49119872-49119894 CCTGAAAGTGATGGGGAATATGG + Intronic
1120442086 14:84554228-84554250 CATTCACGTGAGTTGTAATAGGG - Intergenic
1122157721 14:99760322-99760344 CTATCAAGTCATTGGTAAAATGG + Intronic
1124167456 15:27340515-27340537 CCTTCAAGTTGTTTGTACTATGG - Intronic
1124579249 15:30938223-30938245 CCTTCAAGTAATTAATTATATGG + Intronic
1125142145 15:36421000-36421022 CCTTCAGCTGTTTGGTAATTGGG + Intergenic
1127067476 15:55255751-55255773 CCTTCAAGAAGTTGGTAATTAGG + Intronic
1144383819 17:14730249-14730271 GCTTCAAGTGATTGGAGGTAGGG - Intergenic
1149511588 17:57246557-57246579 TCTTCAAATGATTGTTAATCTGG - Intergenic
1149852085 17:60043805-60043827 CCTTGAACTGAGTGGGAATATGG - Exonic
1153005616 18:496444-496466 CCCTTCACTGATTGGTAATAGGG - Intronic
1156264674 18:35476639-35476661 CTTTAAAGTGATTGTTGATATGG - Intronic
1158216237 18:55103392-55103414 CCTTCCAGTGGATGGTGATATGG + Intergenic
1159773636 18:72578646-72578668 ACTTCAATAGCTTGGTAATAAGG - Intronic
1160310483 18:77785519-77785541 CCTTCAATTCATTCGTAAAATGG + Intergenic
1161505633 19:4641934-4641956 CCTGCAAGTTTTTGGTTATAAGG - Intronic
1163894968 19:20050872-20050894 CCTTCAAATGATGGATGATATGG - Intergenic
1165449967 19:35876528-35876550 CCTTCAAGTGATTGAGGAGAGGG + Exonic
926368793 2:12159729-12159751 CCTTGCAGTGATTGATATTAGGG + Intergenic
929360729 2:41086650-41086672 GTTACAAGTGATTGGAAATATGG + Intergenic
930777564 2:55189434-55189456 CCTTCAAGTCATTGGACATAAGG + Intronic
932004551 2:67915242-67915264 CCATCAAGTTATTGGTGATAGGG - Intergenic
937636730 2:124164639-124164661 CACTAAAGTGATTGGAAATACGG + Intronic
943184796 2:184594235-184594257 CCTTACAGTGGTTTGTAATAAGG + Intergenic
945633687 2:212319244-212319266 CCTTCAAATGTTTGATAGTAAGG + Intronic
945835194 2:214831335-214831357 CCTTCAAGTAAATGCTAATATGG - Intergenic
1175343020 20:58246896-58246918 CCCTCCAGTGTTTGCTAATATGG - Intergenic
1178119431 21:29453123-29453145 ACTTCAAATGATTGGTAAATTGG + Intronic
1180655405 22:17416254-17416276 CCTTAAAATGATTACTAATATGG + Intronic
949559982 3:5192266-5192288 CGTTCAAGGGATTGATAATCTGG - Intronic
960186371 3:114645426-114645448 TCTTCGAGTGATTGGGAAGAAGG - Intronic
960452002 3:117821416-117821438 CTTTCCAATGATTGCTAATATGG + Intergenic
966387497 3:179415606-179415628 CCTTCAAATGATTGGTGTTAGGG - Intronic
970338299 4:15076718-15076740 CTTTAAAGTGATTGTTCATAGGG - Intergenic
970422793 4:15920697-15920719 CCTTCAAGTTACTGGTAACTTGG + Intergenic
973983363 4:56325674-56325696 CCTTCAAGTGATTGGTAATAAGG - Intronic
979793628 4:124816892-124816914 CGTTCAAGTAATTGGGATTATGG + Intergenic
983300532 4:165919607-165919629 CCTCCAAATGAATGGCAATATGG + Intronic
991094594 5:62726200-62726222 CCTTAATGTGAGTGGTAAAAAGG + Intergenic
994025275 5:95074283-95074305 CCTTCAAGTGGATGGTGCTAAGG - Intronic
998073246 5:139215738-139215760 CCTGAAAGTGCTTGGTTATAAGG + Intronic
998534843 5:142920076-142920098 CCTTCAAATGCTTGGTGCTATGG - Intronic
1000537153 5:162493344-162493366 CCTTCATGGGATTTGCAATAAGG + Intergenic
1000979604 5:167802406-167802428 ACTTCTAGTAACTGGTAATAGGG - Intronic
1001428838 5:171643805-171643827 CCTTCAAAGGAATGGCAATAAGG + Intergenic
1003510914 6:6779658-6779680 CCTTCAAGTTACTGGAAATACGG - Intergenic
1006664151 6:35677536-35677558 CCTGCAAGTGCTTTGTAGTAGGG - Intronic
1008316313 6:50046796-50046818 CATTGAAGTGATTGGTAAAGTGG + Intronic
1009268364 6:61586695-61586717 CTTTCAAGTGACTGGGAACATGG - Intergenic
1014410308 6:121109094-121109116 CCTACAAGTGATTGGTCACATGG + Intronic
1015688539 6:135894376-135894398 CCTTCAAGTGAATTCAAATAAGG + Intronic
1015864233 6:137711566-137711588 CCTTCAAGTGTTTGCTCAAATGG - Intergenic
1018147243 6:160903180-160903202 CATTAAAGTAATTGCTAATAGGG + Intergenic
1019879294 7:3844290-3844312 CCTTTAAATAATTGGCAATACGG - Intronic
1026256429 7:68716031-68716053 CCTTCAAGGCATTCGTAATCTGG + Intergenic
1027664626 7:81029826-81029848 CTTTTAGGTGAATGGTAATAAGG - Intergenic
1030119019 7:106088250-106088272 ACATCAAGTTATTGGCAATATGG + Intergenic
1030305955 7:108019014-108019036 CCTTCAATTGGGTGGGAATATGG - Intergenic
1030576673 7:111295812-111295834 CCTCCAAGTGATTGTTACTTTGG - Intronic
1034060760 7:148085876-148085898 CCTTCATTTAATTGGTTATAAGG - Intronic
1038682204 8:29679271-29679293 CCTTCAGGACATAGGTAATATGG + Intergenic
1039353229 8:36785503-36785525 TTTTAAAGTTATTGGTAATATGG + Intronic
1041199207 8:55434531-55434553 CCATCATGGGATTGGTGATATGG + Intronic
1041872842 8:62654673-62654695 TCTTCATGTGATTGATAGTATGG - Intronic
1042185955 8:66136311-66136333 TCTTCAAGTGAAAGCTAATATGG - Intronic
1042414895 8:68508302-68508324 CATTAAAGTGTTTGGTAAAATGG - Intronic
1046156491 8:110297043-110297065 CCAAAGAGTGATTGGTAATAAGG + Intergenic
1046279929 8:112013936-112013958 ATTTAAAGTGATTGTTAATATGG - Intergenic
1046839858 8:118844244-118844266 CCTCCAAGTGGCTGTTAATAAGG + Intergenic
1047157609 8:122338459-122338481 CCTCCAAGTGAGTGGTAGCATGG + Intergenic
1054766189 9:69044577-69044599 GCTTTAAGAGATTGGTGATAAGG - Intronic
1056701292 9:88911646-88911668 CTTTCATGTGATTATTAATATGG - Intergenic
1058146467 9:101417291-101417313 CCTTGAAGTGATGAGAAATAGGG - Intergenic
1186125580 X:6410281-6410303 CCAACAAGTGATTCGGAATATGG - Intergenic
1187869811 X:23755197-23755219 TTTTCAAGTGAAAGGTAATAGGG + Intronic
1196487615 X:116231909-116231931 CCTTAAAGTTATTGGGAAGATGG + Intergenic