ID: 973990970

View in Genome Browser
Species Human (GRCh38)
Location 4:56406762-56406784
Sequence ATTGGCTGGGCAGAGAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 10, 3: 50, 4: 448}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973990970 Original CRISPR ATTGGCTGGGCAGAGAAGAG AGG (reversed) Intronic
900081993 1:865365-865387 ACAGGGTGGGCAGAGAGGAGAGG - Intergenic
900196665 1:1380055-1380077 ATTGGCTGGGCTGGGTGGAGTGG + Intergenic
900423422 1:2565389-2565411 AGAGGCTGGGCAAAGAAGACAGG + Intergenic
901077228 1:6562814-6562836 CTTGGCTGGGCAGAGAGAACTGG + Intronic
902138331 1:14330355-14330377 ATTGGCTGATCAGAAAAGTGAGG + Intergenic
902156731 1:14493485-14493507 ATGGGGTGGGGAAAGAAGAGTGG + Intergenic
902239768 1:15080781-15080803 CTGGGCTGGGCTGAGAACAGAGG + Intronic
902630299 1:17700846-17700868 ATGGGCTGGGAAGGAAAGAGAGG + Intergenic
902729634 1:18361016-18361038 AGTGGGTGAGGAGAGAAGAGAGG + Intronic
903299436 1:22368119-22368141 CTTGGCTGGGCAGAGAAGGCAGG - Intergenic
903611655 1:24619140-24619162 ATGGGCTGGGAAGAGAAAAGAGG + Intergenic
903675556 1:25062467-25062489 AGGGCCTGGGCAGAGAAGGGAGG + Intergenic
903818859 1:26085516-26085538 CTTGAATGGGCAGAGGAGAGAGG - Intergenic
903929161 1:26852484-26852506 AGTGGCTGGCCGGAGAAGGGAGG + Intronic
904075514 1:27839018-27839040 ACTGACTGTGGAGAGAAGAGGGG + Intronic
904161065 1:28522332-28522354 ATTGTGTGGGAAGAGAAGGGAGG + Intronic
904284068 1:29442882-29442904 AGTGTCTGGGAAGAGAGGAGAGG - Intergenic
905126136 1:35717466-35717488 ATTTGCTGGGTGGAGAAGGGAGG - Intronic
905662771 1:39740013-39740035 TATGGGTGGGCAGAGATGAGAGG + Intronic
906125956 1:43427083-43427105 GGGGGCTGGGCAGAGATGAGAGG - Exonic
906322589 1:44826432-44826454 ACAGGCTGGGCAGGGAAGGGTGG + Intronic
906690125 1:47787049-47787071 CATAGCTGGGCACAGAAGAGCGG - Intronic
907451156 1:54546783-54546805 CTTGGATAGGCTGAGAAGAGGGG - Intronic
908131636 1:61081316-61081338 ATTGTTTTGGCAGAAAAGAGGGG - Intronic
909378965 1:74975045-74975067 ATTGGCTGGGAAGAGAGGGTAGG + Intergenic
909403972 1:75265403-75265425 AGGGGCTGGGGAGTGAAGAGAGG + Intronic
909451304 1:75800548-75800570 ATGGGCTGGGAGGAGTAGAGAGG + Intronic
910149638 1:84126483-84126505 AGTGGCAGAGGAGAGAAGAGAGG - Intronic
910769110 1:90812924-90812946 AATGTCGGGGAAGAGAAGAGGGG + Intergenic
911439428 1:97907095-97907117 ATGGGCTGGGCAGGAAGGAGCGG + Intronic
912143308 1:106758541-106758563 ATTGGCTGGGCAGGAAGGGGTGG - Intergenic
913408831 1:118527589-118527611 ATGGGTGGGGCATAGAAGAGAGG + Intergenic
914995912 1:152543330-152543352 AAGTGCTGGGTAGAGAAGAGTGG + Intronic
915440300 1:155941672-155941694 ATTGGTGGTGCTGAGAAGAGAGG - Intergenic
915511702 1:156390284-156390306 CTCGGGTGGGCAGAGGAGAGGGG - Intergenic
915934045 1:160080128-160080150 ATTGACTAGGCAGAGCATAGAGG + Intergenic
916403088 1:164469837-164469859 ATTGGCATGGCAGCCAAGAGAGG + Intergenic
916492763 1:165316313-165316335 ATGGGGAGGGCAGAGCAGAGAGG + Intronic
917839996 1:178969784-178969806 ATTGGGTGGCCAGAGACGTGCGG + Intergenic
917916728 1:179709641-179709663 ATTGCCTGGGCAGAGAGCTGTGG - Intergenic
918161936 1:181909450-181909472 ATTAGCTGGACAAAGAAGGGAGG + Intergenic
918926551 1:190793341-190793363 AAGTGCTGGGTAGAGAAGAGCGG - Intergenic
919183823 1:194118498-194118520 AAGTGCTGGGTAGAGAAGAGTGG - Intergenic
919724428 1:200872890-200872912 AATGGGTGGGCAGGAAAGAGGGG - Intergenic
919755051 1:201061470-201061492 TGGGGGTGGGCAGAGAAGAGAGG + Intronic
920501813 1:206490345-206490367 AGTGGCTGGGCAGAGCGGGGAGG + Intronic
921326133 1:213987765-213987787 AGGGGCTGGGAAGAGAGGAGGGG - Intronic
921690787 1:218147214-218147236 GTTGGCTGGGTAGAGAAGATGGG - Intergenic
922595888 1:226812580-226812602 ATTGGGTGATCAGAGAAGGGTGG - Intergenic
923012923 1:230103437-230103459 GTTGGCTGGGGAGAAAAGGGGGG - Intronic
923603945 1:235426394-235426416 ATCTACAGGGCAGAGAAGAGGGG - Intronic
924235895 1:241999314-241999336 ATTGGCTGGGCAGCGGACTGTGG + Intergenic
924651820 1:245935875-245935897 ATGGGCTGGGGAGAGAAATGGGG + Intronic
1063404189 10:5776863-5776885 AATGGAAGGCCAGAGAAGAGGGG + Intronic
1063532950 10:6853359-6853381 ACTGGCTCTGCAGAGAAGAGAGG + Intergenic
1063545957 10:6981749-6981771 ATAGGCTGGGAAGAGAAGCAGGG + Intergenic
1064039655 10:11949131-11949153 ATTGACTGGGCAGTGAAATGTGG - Intronic
1065496191 10:26331076-26331098 TGTGGCAGGGCAGAGAACAGGGG - Intergenic
1066306688 10:34151394-34151416 TTTGGCACTGCAGAGAAGAGAGG + Intronic
1068407111 10:56604584-56604606 AAGTGCTGGGCAGAGAAGGGTGG + Intergenic
1069840601 10:71337147-71337169 GCTGGCTGGGCAGGGAAGGGGGG - Intronic
1069987232 10:72292708-72292730 CTTGGCAGGGCAGAGGACAGTGG - Intergenic
1070130751 10:73653785-73653807 AATGGGTGGGCCGGGAAGAGTGG + Intronic
1070271965 10:74965257-74965279 ATTGGATGGGACCAGAAGAGGGG - Intronic
1070527520 10:77308110-77308132 ATTGACTGGGCCCAGAAGAGAGG + Intronic
1070624403 10:78039851-78039873 TGTTGCTGGGCAGAGCAGAGGGG + Intronic
1070728917 10:78811546-78811568 AGTCGCTGGGCAGGAAAGAGAGG + Intergenic
1070743522 10:78918483-78918505 ATTTGCTGGGTAGAGAAGCTGGG + Intergenic
1070746054 10:78934714-78934736 ATTGGCTGGGAAGTGAAGCCTGG - Intergenic
1070938533 10:80321550-80321572 ATTGGCTGGGCAGAGAATTCTGG - Intergenic
1072263112 10:93701555-93701577 TTTAGTGGGGCAGAGAAGAGAGG - Intronic
1073761251 10:106631169-106631191 CTTGGCTGGGCATAGAGCAGAGG - Intronic
1073836101 10:107444699-107444721 TTTGGCTAGGAAGAGGAGAGAGG - Intergenic
1073851485 10:107624110-107624132 AAAGGCTGGGAAGAGAAGAGGGG - Intergenic
1075825882 10:125356739-125356761 CATGGCTGGGCAGAGCAGGGAGG - Intergenic
1076056232 10:127375386-127375408 AGTGGCTGGGCAGAGAAGGGAGG - Intronic
1076426826 10:130372951-130372973 ATTGGCTGGACAGCGACGAACGG - Intergenic
1077405959 11:2382653-2382675 CCTGGCTGGGGAGAGAAGTGAGG - Intronic
1077464667 11:2728045-2728067 AGTGGCTGGGGAGGGAGGAGGGG - Intronic
1077583181 11:3430692-3430714 ATTAGCTGGGCATAGTAGTGTGG - Intergenic
1078058132 11:8024136-8024158 ACAAGCTGGGAAGAGAAGAGAGG - Intronic
1078348340 11:10571508-10571530 AGTGGCTGGAAAGGGAAGAGAGG - Intronic
1078559311 11:12356839-12356861 CATGGTTGGGCAGAGAAGAAGGG - Intronic
1080377110 11:31725446-31725468 AATGGCAGGGCAGAGAGAAGGGG - Intronic
1080489628 11:32749589-32749611 AGTGTCTGGGCATTGAAGAGTGG + Intronic
1080918292 11:36682656-36682678 ATTTCCTGGGCAGAAATGAGGGG - Intergenic
1081221640 11:40469982-40470004 GTTGGCTCTGAAGAGAAGAGTGG + Intronic
1081879699 11:46438156-46438178 TTTAGCTGGGCAGTGAAGAATGG + Intronic
1083887151 11:65578444-65578466 GGTGTCTGGGCAGAGATGAGTGG - Intronic
1084209584 11:67614853-67614875 CTGGGCTGAGCAGAGATGAGGGG - Intergenic
1084647989 11:70471773-70471795 CTTGGCTGGGCACAGAACTGAGG + Intronic
1084905492 11:72343050-72343072 ATGTGCAGGGCAGAGAAGAGGGG + Intronic
1084971106 11:72772507-72772529 CCTGTCTGGGCAGTGAAGAGGGG - Intronic
1086062299 11:82712388-82712410 AGTGGGTGGGAAGAGGAGAGAGG - Intergenic
1086156180 11:83668319-83668341 GTTGTCTTTGCAGAGAAGAGTGG - Intronic
1086205290 11:84250630-84250652 TCTGGCTGGGCAGGGAAGATTGG - Intronic
1086330633 11:85750364-85750386 ACGGGCTGGACAGAGAAGTGAGG - Intronic
1086421644 11:86643437-86643459 ATTTCCTGGGAAGAGAAGATGGG - Intronic
1086562272 11:88181496-88181518 AGTGGATGGGCAGAAAAGAAGGG - Intergenic
1086773738 11:90802302-90802324 ATGGGAAAGGCAGAGAAGAGTGG + Intergenic
1087796273 11:102457457-102457479 AAAGGCTGGGGAGAGAAGAATGG + Intronic
1087832843 11:102838288-102838310 ATAGGTTGAGGAGAGAAGAGGGG + Intronic
1087897648 11:103604800-103604822 ACTGCCTGGACAGAGAAAAGAGG - Intergenic
1088171606 11:107004059-107004081 ATTGCCTGGCCTGAGGAGAGGGG - Intronic
1089259903 11:117217104-117217126 ATTGCCTGGGTGGAGAAGAGTGG - Intronic
1089296063 11:117469042-117469064 AGTGGCTGTGGAGGGAAGAGTGG + Intronic
1089581462 11:119484129-119484151 AGTGGCTGGGCATGGAGGAGGGG + Intergenic
1090373446 11:126272769-126272791 AGTGGATGTGCAGAGCAGAGAGG - Intronic
1090468975 11:126961893-126961915 ATTGCCTGTGCAGAGTAGATTGG + Intronic
1090782108 11:130016417-130016439 ATTGCCTGGGGAGTGAAGAGAGG + Intergenic
1090897799 11:130994380-130994402 ATTGGCTGGAGACAGAAGAAGGG + Intergenic
1092246291 12:6866225-6866247 AATGGCTGGGCAGAGCAGAGGGG + Exonic
1092410331 12:8248044-8248066 ATTAGCTGGGCACAGTAGTGTGG - Intergenic
1092930841 12:13314331-13314353 ATAGGGTGGGCACAGAAGGGTGG + Intergenic
1093014178 12:14139554-14139576 ATAGCCTGGGCAGAGTAGGGGGG + Intergenic
1093255373 12:16859943-16859965 TGTTGCTGGGCAGAGAATAGAGG + Intergenic
1093316477 12:17657377-17657399 ATTTGCTGGCCAAAGAGGAGTGG + Intergenic
1093549677 12:20392961-20392983 AGAGGCTGGGAAGGGAAGAGGGG + Intronic
1094136772 12:27136082-27136104 AGAGGCTGGGCAGAGTAGTGAGG + Intergenic
1094604098 12:31935826-31935848 ATTGGCTGGGCACAGCACAGTGG - Intergenic
1094625980 12:32124692-32124714 ATTTTCCGGGGAGAGAAGAGGGG + Intronic
1094827785 12:34286241-34286263 AATGGCTTGGAAGAGAAGGGGGG + Intergenic
1094833127 12:34309504-34309526 AATGGCATGGCAGAGAAGGGTGG + Intergenic
1094837301 12:34328152-34328174 AATGGCATGGCAGAGAAGGGCGG - Intergenic
1095137624 12:38625049-38625071 ACTGGCTGGACAGAGAACAAAGG - Intergenic
1095331057 12:40964947-40964969 TTTGTCTGGACAGTGAAGAGTGG - Intronic
1095633147 12:44401238-44401260 CTTGGCTGGGCATAGATGATTGG - Intergenic
1096228678 12:49885358-49885380 ATTTGCAGGGGACAGAAGAGGGG - Intronic
1096483682 12:51961046-51961068 TTTGGCTAGGAAGAGAAGTGGGG - Intronic
1097881883 12:64693947-64693969 CTTGGGTGGGAAGAGAGGAGAGG + Intronic
1098072646 12:66692655-66692677 ATTGTCATGGCAGAGAGGAGGGG + Intronic
1099049223 12:77763173-77763195 CTTGGGTGGAGAGAGAAGAGTGG + Intergenic
1099289074 12:80752684-80752706 ATTGGCTAGGCTGAGATGAATGG + Intergenic
1100913877 12:99395474-99395496 ATTGGATGTGCAAAGATGAGGGG - Intronic
1101346478 12:103890695-103890717 AGTGGCTGGGCAGAGCTGGGGGG + Intergenic
1103362968 12:120364572-120364594 ATGGGCTGGGCTGGGAAGAGGGG - Intronic
1103733430 12:123043445-123043467 CTGGCCTGGGCAGTGAAGAGGGG + Intronic
1104477868 12:129085072-129085094 AGTCACTGGGCAGAGAAGCGGGG - Intronic
1110350036 13:74496108-74496130 ATTGGATAGGGAAAGAAGAGGGG + Intergenic
1111094762 13:83498402-83498424 ATTGGATCTGCAGAGAAGTGGGG + Intergenic
1112190886 13:97176103-97176125 ATTTGCCTGGCAGAAAAGAGAGG - Intergenic
1112540418 13:100306247-100306269 AAGGGGTGGGAAGAGAAGAGCGG - Intronic
1112755504 13:102628291-102628313 ATTGCCTGGGAAGAGAAGTGAGG - Intronic
1113197988 13:107831791-107831813 TCTGTCTGGGCAGAGATGAGAGG - Intronic
1113218512 13:108071009-108071031 AATGGCAGGACAAAGAAGAGAGG + Intergenic
1113395188 13:109940836-109940858 AAGGGCTGGTCAGAGAAGAGTGG - Intergenic
1115040823 14:28924580-28924602 AATGGGTGGGCAGAAAAAAGTGG - Intergenic
1115318512 14:32052465-32052487 ATTCACTGGGTGGAGAAGAGTGG - Intergenic
1115445932 14:33489746-33489768 ATTGGCTGGCCTCAGAATAGGGG + Intronic
1116505059 14:45667729-45667751 AATGGGTGGCCTGAGAAGAGTGG + Intergenic
1116898857 14:50342800-50342822 ATAAGCTGGGAAGAGAAGGGTGG + Intronic
1117026498 14:51625723-51625745 TTTGGATAAGCAGAGAAGAGAGG - Intronic
1118571851 14:67201975-67201997 ACTGGCTGGGTTGAGAGGAGAGG - Intronic
1118809452 14:69262206-69262228 AGAGGCTGGGCAGGGAGGAGAGG + Intronic
1119182531 14:72614461-72614483 AGTAGCTGGGAAGGGAAGAGGGG - Intergenic
1119660254 14:76446031-76446053 AATGGCGGGGGAGGGAAGAGGGG + Intronic
1120512006 14:85426606-85426628 CTTGGCTGGGGCGAGATGAGAGG - Intergenic
1120908132 14:89638781-89638803 ATAGGCAGGGCAGAGCACAGAGG + Intronic
1121432704 14:93898950-93898972 ATATCCTGGGCAGAGAAGCGAGG - Intergenic
1121501541 14:94442189-94442211 ATGGGCTGTACAGACAAGAGAGG - Intergenic
1124003714 15:25780063-25780085 ATTGGCTGGGCAGGGTTGTGGGG - Intronic
1124431371 15:29611563-29611585 AGTGGCTGGGAAGGGCAGAGGGG - Intergenic
1125754540 15:42054120-42054142 CCTGGCTGGGCAGGGAAGTGGGG - Intergenic
1126098620 15:45106499-45106521 AGGGGCTGGGCAGAGGAGGGAGG - Intronic
1126572231 15:50164519-50164541 ATTGTTTGAGGAGAGAAGAGGGG - Intronic
1128220087 15:65962933-65962955 ATTGGATGGGCTGAGATTAGCGG + Intronic
1128356982 15:66935035-66935057 GATGGCTGTGCAGAGGAGAGTGG - Intergenic
1129505580 15:76078980-76079002 ATGGATGGGGCAGAGAAGAGAGG - Intronic
1129879256 15:78996257-78996279 ATTGGGAGAGCAGAGGAGAGTGG + Intronic
1130578785 15:85116647-85116669 GTTGGCTGGGCACACAAGAAAGG + Intronic
1130864636 15:87922005-87922027 ATCATCTGGGCAGAGAAGAGAGG + Intronic
1131569807 15:93523466-93523488 ATGGGATGGGGGGAGAAGAGGGG - Intergenic
1132965132 16:2649270-2649292 ATTGGATGTGTAGAGAACAGCGG - Intergenic
1133351546 16:5104234-5104256 ATTAGCTGGGCATAGTAGTGTGG - Intergenic
1134453956 16:14380164-14380186 ATTTTCTGGGCAGAGGAGAAAGG - Intergenic
1135384919 16:22030033-22030055 ATCTGCTGGGGAGAGTAGAGTGG - Intronic
1135464693 16:22675313-22675335 CTTGGCTGAGAAGAGAAGGGAGG + Intergenic
1135589044 16:23692150-23692172 CTGGGCAGGGCAGAGAAGGGAGG - Intronic
1136292912 16:29286542-29286564 ATTGGCTGGGTTTAGGAGAGTGG + Intergenic
1137505806 16:49052829-49052851 ATCTGATGGGCAGAGAAGAATGG + Intergenic
1137738336 16:50741838-50741860 AGGGGCGGGGCAGAGAAGAGCGG - Intergenic
1138125144 16:54432598-54432620 AATGGCTGGGCGGAACAGAGGGG + Intergenic
1138514134 16:57526650-57526672 ATGGGCGGGGCGGAGAAGAAGGG - Intronic
1138541229 16:57688969-57688991 ATTGGATGGGCAGAGACCAGGGG - Exonic
1139579231 16:67862439-67862461 CCTGGTAGGGCAGAGAAGAGTGG - Intronic
1139925424 16:70483176-70483198 ATGGGGTGGGGAGAGGAGAGAGG - Intronic
1141647794 16:85376755-85376777 CTTTGCTGGGCAGAGAGCAGGGG + Intergenic
1141954179 16:87359258-87359280 AGGGGGTGGGCACAGAAGAGGGG - Intronic
1142098798 16:88260548-88260570 ATTGGCTGGGTTTAGGAGAGTGG + Intergenic
1142805050 17:2367144-2367166 ATCTGCAGGGCACAGAAGAGGGG - Intronic
1143395316 17:6589931-6589953 TTCGGCTAGGGAGAGAAGAGGGG + Exonic
1143538180 17:7554130-7554152 GTAGGGAGGGCAGAGAAGAGAGG - Intronic
1143542116 17:7575246-7575268 ATTGGCTCAGCAGGTAAGAGTGG + Exonic
1143886565 17:10069274-10069296 ACTGGATGGGCAGACAAAAGGGG - Intronic
1144494174 17:15736434-15736456 ATGGGGTGGGCAGGGAACAGTGG + Intronic
1144906087 17:18640242-18640264 ATGGGGTGGGCAGGGAACAGTGG - Intronic
1145950390 17:28812505-28812527 ATTGGCTGTGCAGACAGGAGAGG - Intronic
1146822148 17:35992194-35992216 TTTTGCTGGGCAGAGTTGAGAGG + Intronic
1147154233 17:38535524-38535546 AATGGATGAGCAGAGGAGAGGGG - Intronic
1147360136 17:39925140-39925162 ATGGGCAGGACAGAGAAGAACGG - Intronic
1147381270 17:40057630-40057652 CTTGGCTAGAGAGAGAAGAGGGG + Intronic
1147426510 17:40348298-40348320 AATGGCTAGAGAGAGAAGAGGGG - Exonic
1147661109 17:42117592-42117614 CTCGTCTGGGCACAGAAGAGGGG + Exonic
1148123540 17:45225479-45225501 TTGGGCTGGGCAGAGGGGAGGGG + Intronic
1148244990 17:46024720-46024742 AGGGGCTGGGCAGAGGGGAGAGG + Exonic
1149521866 17:57323691-57323713 CCAGGATGGGCAGAGAAGAGGGG + Intronic
1149912241 17:60577179-60577201 ATTCCCTTGGCAAAGAAGAGAGG - Exonic
1150798249 17:68257351-68257373 CTTGGCTGGGCCTAAAAGAGGGG - Intergenic
1151164405 17:72191659-72191681 AGGGGCTGAGCAGAGAAGATGGG - Intergenic
1151230193 17:72679106-72679128 AGAGGCTGGGGAGGGAAGAGAGG + Intronic
1151476072 17:74344969-74344991 CTGGGCTGGGCAGAGGAGGGAGG + Intronic
1151494141 17:74449554-74449576 ATGGGCTGGGCAGGAAAGGGAGG - Intronic
1151572061 17:74931419-74931441 AGGGGCTGGGCAGAGGTGAGAGG + Intronic
1152025975 17:77809498-77809520 ATAGCATGGGCAGAGAAAAGGGG - Intergenic
1154057732 18:11027373-11027395 ATTGCCTGGTCAGAGCAAAGGGG + Intronic
1155088602 18:22483432-22483454 GGTGGCTGTGCAGAGAAGAGAGG + Intergenic
1155422316 18:25668494-25668516 ATTGGAAGGGCAGTGAATAGAGG + Intergenic
1155514867 18:26614488-26614510 GTGGGATGGGCAGAGAGGAGAGG + Intronic
1155832247 18:30532480-30532502 ATTGGCTGGGAAGGGGAGAGAGG + Intergenic
1156175608 18:34542007-34542029 AGTGGAGAGGCAGAGAAGAGTGG + Intronic
1156657700 18:39308600-39308622 AAGGGCTGGGTAGAGAAGGGCGG + Intergenic
1157812409 18:50706807-50706829 AGTGGCTGGGCTGGGTAGAGAGG - Intronic
1160560209 18:79751187-79751209 AGGGGCTGGGCACAGAAGACAGG + Intronic
1161466645 19:4434498-4434520 ATTGGACGGGCAGAGCACAGGGG - Intronic
1161889010 19:7020113-7020135 AGTGGCAGGGAAGAGAAGAGAGG - Intergenic
1161890356 19:7031903-7031925 AGTGGCAGGGAAGAGAAGAGAGG + Intronic
1161891092 19:7038830-7038852 AGTGGCAGGGAAGAGAAGAGAGG - Intronic
1161892444 19:7050636-7050658 AGTGGCAGGGAAGAGAAGAGAGG + Intronic
1161893177 19:7057291-7057313 AGTGGCAGGGAAGAGAAGAGAGG - Intronic
1162048506 19:8017604-8017626 GTCGGCTAGGCAGAGAAGAGAGG + Intronic
1163082611 19:14954501-14954523 ATGGGCGGGGCTGAGAACAGGGG + Intronic
1163324088 19:16592123-16592145 ATTGGCTGGCCACAGAAGTAGGG - Intronic
1164613631 19:29650987-29651009 AGTGGCTTGGCTGAGAGGAGGGG + Intergenic
1165094810 19:33404300-33404322 ATAGCCTGGGCAGAGAGGACAGG + Intronic
1165236372 19:34425031-34425053 ATTGGCTGGGCACAGCACATTGG - Intronic
1165389514 19:35530222-35530244 GGTGGCTGGGCAGAGAAGAGTGG + Intergenic
1165878287 19:39025087-39025109 TTTGGTTGGGAGGAGAAGAGAGG + Exonic
1166432798 19:42741237-42741259 ATAAGCTGGGCAGAGAAGAGAGG - Intronic
1166435908 19:42766464-42766486 ATCAGCTGGGCAGAGAAGAGAGG - Intronic
1166445783 19:42856492-42856514 ATCAGCTGGGCAGAGAAGAGAGG - Intronic
1166448770 19:42880452-42880474 GTCAGCTGGGCAGAGAAGAGAGG - Intronic
1166453177 19:42918640-42918662 ATCAGCTGGGCAGAGAAGAGAGG - Intronic
1166455659 19:42937951-42937973 ATCAGCTGGGCACATAAGAGAGG - Intronic
1166465452 19:43027226-43027248 ATCAGCTCGGCAGAGAAGAAAGG - Intronic
1166471583 19:43083430-43083452 ATCAGCTGGGCAGAGAAGAGAGG - Intronic
1166482726 19:43187246-43187268 GTCAGCTGGGCAGAGAAGAGAGG - Intronic
1166485201 19:43206380-43206402 ATCAGCTGGGCAGAGAAGAGAGG - Intronic
1166492351 19:43270298-43270320 ATCAGCTGGGCAGAGAAGAGAGG - Intergenic
1166576185 19:43840533-43840555 ATTGGCTGGACTGAGAAATGGGG + Intronic
1167324088 19:48813344-48813366 AGTGGCTGGGGAGAAAAGAGGGG + Exonic
1167353536 19:48990441-48990463 ATAGACTGGGGACAGAAGAGAGG - Intronic
1167608535 19:50494691-50494713 GCTGGCAGGGCAGAGAGGAGGGG + Intergenic
1168601190 19:57720006-57720028 AGGGACTGGGGAGAGAAGAGAGG + Exonic
925205268 2:2000579-2000601 ATTGGGAGGGCAGAGGAGCGGGG - Intronic
925599399 2:5592096-5592118 CTTGGCTAGGAAGAGAGGAGAGG + Intergenic
925619447 2:5776896-5776918 AGGGGCTGGGGAAAGAAGAGGGG + Intergenic
925890484 2:8430328-8430350 CTTGGCTGGGCTGAGTGGAGTGG + Intergenic
925943681 2:8841702-8841724 ATGCCCTTGGCAGAGAAGAGGGG + Intergenic
926587229 2:14700378-14700400 TTTTGCTGGGCAGGGAATAGTGG + Intergenic
926591964 2:14749909-14749931 ATGGGATTGGCAGAGAAGAAAGG + Intergenic
926658352 2:15435383-15435405 ATAGGCTGGGCAGAGTTGAATGG - Intronic
927518910 2:23687713-23687735 ATTGTCCGGGCAGACAAGTGGGG + Intronic
927599915 2:24431751-24431773 ATTAGCTGGGCCCAGGAGAGAGG + Intergenic
928194609 2:29206213-29206235 AAGGGAGGGGCAGAGAAGAGAGG - Intronic
928792980 2:34981046-34981068 ATTAGTTTGGCAGAGAAGAACGG + Intergenic
929020607 2:37548613-37548635 ATCTGCTGGGTAGAGATGAGGGG + Intergenic
929692711 2:44087671-44087693 ATTAACTGGGGAGAGAAGAAAGG + Intergenic
931755509 2:65370782-65370804 ATGGGCTGGTCAGGAAAGAGGGG - Intronic
932223845 2:70023328-70023350 ATTTGCAGGGGAGGGAAGAGAGG + Intergenic
932694958 2:73948162-73948184 CATGGCTTGGGAGAGAAGAGAGG - Intronic
933609145 2:84415938-84415960 CATGGCAGGGCAGAGAAGGGTGG - Intergenic
934648490 2:96073140-96073162 GTGTGCTGGGCAGAGAAGAAGGG + Intergenic
934841724 2:97628164-97628186 GTGTGCTGGGCAGAGAAGAAGGG + Intergenic
934965499 2:98718529-98718551 ACTGGTTGGGGAGAAAAGAGGGG - Intronic
936563365 2:113561554-113561576 ATTATCTGGGAAGAGAGGAGAGG + Intergenic
937009134 2:118545980-118546002 AGTGACTGGGCAGAGCTGAGTGG + Intergenic
937118834 2:119428092-119428114 ACTGGAGGGGCAGAGAGGAGAGG + Intergenic
937831506 2:126429498-126429520 ACTGGCTTGGCAGAGCAGTGTGG - Intergenic
937982363 2:127623107-127623129 ATGGGCTGGGGAGAGGAGGGAGG + Intronic
939825780 2:147014098-147014120 ATGGTGTGGGAAGAGAAGAGTGG - Intergenic
941159627 2:162021867-162021889 ATTGATTGGGCAGAGGGGAGAGG - Intronic
942037163 2:172021632-172021654 AAAGGCTAGACAGAGAAGAGCGG + Intronic
942294871 2:174507551-174507573 ATTGCTTGAGGAGAGAAGAGGGG + Intergenic
942459206 2:176158078-176158100 CTTGGGTGGGGAGAGAGGAGCGG - Intronic
942652385 2:178182224-178182246 CCTGGCTGGGCAAAAAAGAGAGG + Intergenic
943317382 2:186406958-186406980 ATAGACTGGGCAAAGAGGAGTGG - Intergenic
943341092 2:186683183-186683205 ATTGGCTGGACTGAGAACTGAGG + Intergenic
944614614 2:201447794-201447816 TTAGCCTGGGCAGAGAAAAGGGG - Intronic
944864516 2:203847495-203847517 ATTGGCTTGGCAGGCAAGAGAGG - Intergenic
945350255 2:208769223-208769245 ATTGGACAGGTAGAGAAGAGTGG + Intronic
945426400 2:209709925-209709947 ATTCGCAGAGCAGGGAAGAGTGG + Exonic
945680585 2:212909300-212909322 ATTGGCAGGGCTGTGGAGAGAGG + Intergenic
946116250 2:217465039-217465061 CTTGACTGGGAAGAGAAGTGGGG + Intronic
947874184 2:233457644-233457666 GTTAGGTGGGCAGAGGAGAGGGG + Intronic
948403823 2:237702975-237702997 ATTGTATGGGCAGAGAAAGGAGG + Intronic
948692957 2:239718521-239718543 AGTGCTTGGGCAGGGAAGAGTGG + Intergenic
1168979202 20:1990599-1990621 ATTTGCTGTGCAGAGACCAGAGG + Intronic
1169928522 20:10807841-10807863 CATAGCAGGGCAGAGAAGAGTGG + Intergenic
1171948830 20:31402822-31402844 ATTAGCTGGGCAGTGTTGAGTGG + Intergenic
1172890319 20:38259907-38259929 ATTGGCTGGGGAGAGGGAAGAGG - Intronic
1173472593 20:43335352-43335374 GGTGGCTGGGCAGAGAAAAATGG + Intergenic
1173724569 20:45288477-45288499 AGGGGCTGGGCAGAGAAGGCAGG - Intergenic
1173838987 20:46144725-46144747 GTTGGCCAGGCAAAGAAGAGGGG + Intergenic
1173913194 20:46685798-46685820 TTTGGGTGGGAAGGGAAGAGAGG - Exonic
1175283170 20:57819058-57819080 CTCGGCTGGGGAGAGAAGTGTGG - Intergenic
1175445231 20:59015382-59015404 AATGTCTGGGCAGAACAGAGTGG - Intergenic
1175628762 20:60513268-60513290 ATTGACTGGAAAGGGAAGAGGGG - Intergenic
1175823700 20:61925150-61925172 ATGGGCTGGGCAGAGACGGCAGG + Intronic
1176128735 20:63487389-63487411 CTTGGCTGGGAAGAGTGGAGGGG - Intergenic
1176942490 21:14940793-14940815 GTTGGTTGAGAAGAGAAGAGGGG - Intergenic
1177049268 21:16211457-16211479 TGTGGCTGGGCACTGAAGAGTGG - Intergenic
1177893795 21:26837848-26837870 ATTGGGTTGGCAGAGAAGACTGG - Exonic
1178797522 21:35758631-35758653 AGAGGCTGGGAAGGGAAGAGGGG + Intronic
1178798483 21:35768064-35768086 ATGGGCTGGACAGAGGACAGGGG - Intronic
1178964189 21:37100105-37100127 AGTGGCTGGGGAGAGAAGGAGGG + Intronic
1179554274 21:42162613-42162635 TATGGCTGGGCAGAGGTGAGTGG + Intergenic
1180147911 21:45931479-45931501 ATTGGGTGGGCAGCGATGGGAGG + Intronic
1180654653 22:17409638-17409660 ATTGACTGGGTTGGGAAGAGAGG - Intronic
1181163530 22:20971483-20971505 ATGGGCTGGGCAGCCAGGAGAGG + Intronic
1182018610 22:27061936-27061958 ATTGGCTGGGTTGAGACCAGAGG - Intergenic
1182375742 22:29846457-29846479 ATTGGCTGGGCTAAGCTGAGTGG + Intergenic
1183168434 22:36165719-36165741 GTAGGTTGGGCAGAGAAAAGTGG - Intronic
1184205332 22:42998843-42998865 AGTGGCAGAGGAGAGAAGAGAGG + Intronic
1184334944 22:43847586-43847608 GGAGGCTGGCCAGAGAAGAGGGG - Intronic
950114841 3:10444161-10444183 ACTGCCTGGCCAGAGATGAGTGG - Intronic
950246071 3:11419701-11419723 AATGCCTAGGCAGAGAAGATAGG + Intronic
953929303 3:46997976-46997998 CATGGCTGTGCAGGGAAGAGTGG + Intronic
954208319 3:49077331-49077353 CTTGGCTCTGCAGAGAAGATGGG - Intronic
954395036 3:50289032-50289054 AGGGGCCAGGCAGAGAAGAGAGG - Intronic
955061038 3:55491620-55491642 ATTTGCTGGGCATAAAAGGGGGG - Intergenic
955677626 3:61465315-61465337 ACTGGTGGGGCAGAGAAGGGAGG - Intergenic
957055571 3:75440174-75440196 ATTAGCTGGGCACAGTAGTGTGG - Intergenic
957329304 3:78739992-78740014 ATTGGCTGGTTAGGGAAGAGAGG - Intronic
957376282 3:79363097-79363119 AGTGGCTGAGAAGAAAAGAGTGG - Intronic
957753202 3:84450083-84450105 GTTGGGTTGGCAGAGAAAAGGGG + Intergenic
959615206 3:108339813-108339835 ATTTGTTGGCCAGGGAAGAGTGG + Intronic
960009450 3:112817595-112817617 TGAGGCAGGGCAGAGAAGAGAGG - Intronic
963429787 3:145185011-145185033 AGAGGCTGGGCAGAGTAGTGGGG + Intergenic
964025711 3:152071247-152071269 ATGGGCTGTGCTGGGAAGAGAGG - Intergenic
964282601 3:155082469-155082491 ATTGGTTGGGCAAAGGAAAGAGG - Intronic
964340665 3:155705527-155705549 ATTGGCTGGGGAGAGGGCAGAGG - Intronic
964509871 3:157438423-157438445 AATGGGTGGGCGGAGAGGAGGGG - Intronic
964808971 3:160641976-160641998 ATGGGCTGGACAAAGAAGAGAGG + Intergenic
967110381 3:186288299-186288321 GTTGCCTGGGCACAGAATAGGGG + Intronic
967708769 3:192681965-192681987 AAAGGGTGGGCAGAGAAGAATGG - Intronic
968620686 4:1602165-1602187 AGTGGCTGGGCAGAGATGCAGGG + Intergenic
968712274 4:2127482-2127504 CTTTCCTGGGCAGAGGAGAGGGG + Intronic
968998384 4:3960472-3960494 ATTAGCTGGGCATAGTAGTGTGG - Intergenic
969313345 4:6366999-6367021 AGTGTCTGGGGAGAGTAGAGAGG + Intronic
969755617 4:9148172-9148194 ATTAGCTGGGCATAGTAGTGTGG + Intergenic
969815509 4:9684300-9684322 ATTAGCTGGGCATAGTAGTGTGG + Intergenic
969848417 4:9937674-9937696 GATGGCTGAGGAGAGAAGAGGGG - Intronic
971468460 4:26991415-26991437 AGAGGCTGGGAAGCGAAGAGGGG + Intronic
972108640 4:35526008-35526030 AAGGGCTGGGTAGAGAAGGGCGG - Intergenic
972214556 4:36880551-36880573 ATTAGCTTGGCAGAGGAGAGAGG - Intergenic
972339806 4:38142252-38142274 CTTGGCTGAGCAGAGCAGAGAGG + Intergenic
972469001 4:39385634-39385656 ATTGGCTGGGCCGGGTACAGTGG - Intergenic
973240748 4:47953845-47953867 AAGTGCTGGGTAGAGAAGAGTGG + Intronic
973562173 4:52148346-52148368 ATGTGCTGAGGAGAGAAGAGAGG + Intergenic
973990970 4:56406762-56406784 ATTGGCTGGGCAGAGAAGAGAGG - Intronic
974084131 4:57241481-57241503 ATTCACTAGGCAGAGAAGAATGG + Intergenic
974705169 4:65505992-65506014 ATGGGGTGGGCAGAGCAGGGAGG - Intronic
975094968 4:70447063-70447085 GGTGGGTGGGCAGGGAAGAGGGG + Intronic
975876098 4:78838562-78838584 TTTGGAAGGGCAGAGAATAGAGG + Intronic
977347099 4:95829998-95830020 ATAGGCTGGCCTGAAAAGAGTGG + Intergenic
978922542 4:114201505-114201527 ATTGCCAGGGCATAGAGGAGGGG + Intergenic
980438234 4:132809202-132809224 ATGTGCTGGGTAGAGAAGGGCGG + Intergenic
982064960 4:151646227-151646249 ATTGGTCAGGCAGAGAAAAGGGG + Intronic
982176815 4:152713444-152713466 AGAGGCTGGGAAGGGAAGAGGGG + Intronic
983450958 4:167910736-167910758 CTTGGTTTAGCAGAGAAGAGGGG - Intergenic
983719696 4:170834321-170834343 ATTGACTATGCAGAGAAGGGAGG + Intergenic
984005492 4:174301454-174301476 ATTGGATAAGCAAAGAAGAGTGG + Intronic
985689458 5:1299100-1299122 AAGTGCTGGGCAGAGAAGGGCGG + Intergenic
985841088 5:2306530-2306552 GGTGGCTGGGCAAAGAAGGGGGG - Intergenic
985980065 5:3455351-3455373 CTTGAATGGGAAGAGAAGAGAGG + Intergenic
986157238 5:5188534-5188556 ATTGACTGGGCAAAGGAGAGTGG + Intronic
986552430 5:8973710-8973732 GTTGGCTGGGCAGAGGACTGTGG + Intergenic
988379169 5:30478555-30478577 ATGGGGTGGGGAGAGAAGAGAGG + Intergenic
988508416 5:31844211-31844233 ATTGCTTGGGAAGAGAAGAAGGG + Intronic
988554457 5:32224064-32224086 ATCAGCTGGGGAGAGAGGAGAGG + Intergenic
988724288 5:33910384-33910406 ATGGGGTAGGCAAAGAAGAGAGG + Intergenic
991348573 5:65696168-65696190 CTTGGATAGGCAGAGGAGAGGGG - Intronic
991382964 5:66051602-66051624 ATTGGCTGGGCTGAGCATGGTGG + Intronic
992130382 5:73685979-73686001 CTTGGCTGGGTAGTGAAGTGTGG - Intronic
995479539 5:112580904-112580926 ATGGGATGGGCAGAGAGGATGGG - Intergenic
995566492 5:113436357-113436379 ATGGCCTTGGCTGAGAAGAGGGG - Intronic
998102884 5:139448951-139448973 ATTGGCAGGGTACAGAAGAGGGG + Intronic
1000138717 5:158380755-158380777 ATTGGCTATGCAGAGAAAGGAGG + Intergenic
1000211526 5:159110674-159110696 TTTGGCAGGGCAGAGGAGCGGGG - Intergenic
1000432756 5:161169386-161169408 ACTGTTTTGGCAGAGAAGAGAGG - Intergenic
1001884611 5:175278071-175278093 AAGGGCTGGAAAGAGAAGAGGGG + Intergenic
1002165036 5:177338695-177338717 CTTAGCTGGGGAGAGAAGAGAGG - Intronic
1002558968 5:180067654-180067676 ATAGGCTGGCAAGAGAAAAGGGG - Intronic
1003148698 6:3530626-3530648 ATGAACTGGGCAGAGAAGAGAGG + Intergenic
1004129535 6:12905660-12905682 ATTAACCAGGCAGAGAAGAGAGG + Intronic
1004187549 6:13433807-13433829 ATGGTTTGGGCAGAGGAGAGAGG - Intronic
1004271360 6:14198984-14199006 GGTGGCTGGGCAGAGACAAGCGG - Intergenic
1004828677 6:19452635-19452657 AATGTCTGAGCAGACAAGAGAGG + Intergenic
1005128297 6:22473561-22473583 ATGAGCTGAGCAGAGGAGAGTGG + Intergenic
1007425649 6:41744367-41744389 CTGGGCTGGGCAGAGAGGGGTGG - Intronic
1007774392 6:44216860-44216882 ATTGGTGGGGCAGAGCAGGGCGG + Intergenic
1009593851 6:65709178-65709200 ATTGGCTGGGCATGGTGGAGGGG - Intergenic
1009726975 6:67548171-67548193 AGAGGCTGGGAAGGGAAGAGAGG - Intergenic
1010321650 6:74517505-74517527 ATGAGCTGAGCAGAGAAGATTGG + Intergenic
1011488480 6:87867458-87867480 ATTACCTGGGAAGAGAAGAGTGG - Intergenic
1011488550 6:87868121-87868143 ATTACCTGGGAAGAGAAGAGTGG + Intergenic
1011732352 6:90278336-90278358 CTTGGCTGGGCACTGACGAGTGG - Intronic
1013368929 6:109454217-109454239 AGCAGCTGGGCAGAGATGAGTGG + Exonic
1015843627 6:137496742-137496764 ATTGTCTGGTCAGAGCAGAAGGG + Intergenic
1016700554 6:147049120-147049142 ATTTACTGAGCTGAGAAGAGTGG - Intergenic
1017128746 6:151090316-151090338 AGGGGCTGGGCAGTGAAGTGAGG + Intronic
1017139892 6:151180939-151180961 ATGAGCTGAGCAGAGAAGGGTGG + Intergenic
1017635571 6:156439830-156439852 ATAGACTGGGCAGAGTGGAGTGG - Intergenic
1018153720 6:160965471-160965493 ACTGGCTGGGCAGACAGGTGTGG + Intergenic
1018205815 6:161436223-161436245 GATGGGAGGGCAGAGAAGAGGGG + Intronic
1018416424 6:163605892-163605914 ACAGGCTGGGCAGAGGTGAGTGG + Intergenic
1018479629 6:164176920-164176942 GTTGAATGGGCAGAGGAGAGAGG - Intergenic
1018541904 6:164890193-164890215 ATTGGATGGGCACAGGAGAGAGG - Intergenic
1018592758 6:165445302-165445324 CTTTGCTGGGCTGAGAAGAATGG + Intronic
1019109773 6:169700528-169700550 AGTGGGTGGGGAAAGAAGAGAGG - Intronic
1019266462 7:119946-119968 ATTGGCAGGGCAGGGAAGGCCGG + Intergenic
1019325777 7:437581-437603 AATGGCTGGGCTGAGCAGTGCGG - Intergenic
1019662686 7:2233473-2233495 AGGGGCTGGGCAGAGACGGGAGG - Intergenic
1020123284 7:5517788-5517810 AGTGGCTGAGCAGAGGAGAAAGG - Intergenic
1021406755 7:20276834-20276856 ATAGTCTGAGCTGAGAAGAGTGG - Intergenic
1022475036 7:30704505-30704527 AGAGCATGGGCAGAGAAGAGAGG + Intronic
1022650286 7:32267766-32267788 CTTGGCTGGACAGAGAAATGAGG - Intronic
1023120948 7:36907763-36907785 ATTGGCATGGGAGAGAGGAGTGG - Intronic
1027669543 7:81078402-81078424 AAGTGCTGGGTAGAGAAGAGTGG - Intergenic
1028091855 7:86712639-86712661 AGAGGCTGGGAAGAGTAGAGGGG - Intronic
1028512358 7:91639239-91639261 AGAGGCTGGGAAGAGAAGTGGGG + Intergenic
1028600201 7:92592653-92592675 TTTGGGAGGGGAGAGAAGAGAGG + Intergenic
1028899729 7:96084055-96084077 TTAGGCTGGGGAGAAAAGAGGGG + Intronic
1029195547 7:98802812-98802834 ATTGGCTGGGCAGGCAAGGTTGG + Intergenic
1030048969 7:105521790-105521812 ACTGGCCGGGCAGAGCGGAGCGG + Intronic
1031973112 7:128077804-128077826 AAGAGCTGGGCAGAGAACAGGGG - Intronic
1032488951 7:132309525-132309547 GTTGTGTGGGCAGAGAGGAGAGG - Intronic
1032549983 7:132776180-132776202 GTTGGCTGGGGAAAGAAGGGTGG - Intergenic
1034427356 7:151021127-151021149 AGAGGGTGGGCAGAGGAGAGGGG - Intronic
1035165235 7:156985484-156985506 GCTGGGTGGGCAGAGCAGAGAGG + Intergenic
1035224318 7:157425126-157425148 GTGGGCTTTGCAGAGAAGAGGGG + Intergenic
1035523275 8:292189-292211 ACAGGGTGGGCAGAGAGGAGAGG + Intergenic
1036378863 8:8223481-8223503 ATTAGCTGGGCATAGTAGTGTGG + Intergenic
1036938944 8:13032694-13032716 ATTGGCAGGACAGATAAGATGGG + Intergenic
1037061028 8:14509822-14509844 AGTGGCAGGAGAGAGAAGAGGGG + Intronic
1037340979 8:17844612-17844634 GCTGGCTAGGCAGAAAAGAGAGG + Intergenic
1037585898 8:20275722-20275744 AGTGACTGGGCAGAGAGAAGGGG + Intronic
1039539206 8:38349017-38349039 GTTGTCTTGGCATAGAAGAGTGG - Intronic
1040484890 8:47860507-47860529 TGAGGCTGGGCACAGAAGAGTGG + Intronic
1042617496 8:70666400-70666422 ATTAGCTGGGTAAAGAAGGGAGG + Intronic
1043762755 8:84089577-84089599 AGAGGCTGGGAAGAGTAGAGAGG - Intergenic
1044591317 8:93916853-93916875 ATTGGCTGCGCAGTGACGAGTGG - Intronic
1044676995 8:94739164-94739186 AGAGGCTGGGAAGAGTAGAGGGG - Intronic
1047033559 8:120910654-120910676 ATTTGGTGTGGAGAGAAGAGAGG - Intergenic
1047062818 8:121247416-121247438 TTTGGTTGGGGAGGGAAGAGTGG - Intergenic
1047251908 8:123187084-123187106 GTTTGCTGGGCAGAGAAGGAAGG + Intronic
1047288314 8:123507054-123507076 CGTGGCCGGGCAGAGAAGACTGG - Intronic
1047321074 8:123783738-123783760 ATTGGCTGGGCAGAGCACTTTGG + Intronic
1047369814 8:124247046-124247068 ATTGGATATGCAGAGAAGATGGG - Intergenic
1047971636 8:130089454-130089476 ATGGGCTGAGGAGAGATGAGAGG + Intronic
1048631162 8:136243965-136243987 GATGGCTGGGAAGAGAAGTGTGG - Intergenic
1049549585 8:143250954-143250976 GCTGGCTGGGCAGGGATGAGTGG - Exonic
1049765059 8:144351344-144351366 TTGGGCTGGTCAGAGTAGAGAGG - Intergenic
1049790191 8:144468857-144468879 ATAGGCTGCCCAGAGAGGAGGGG - Intronic
1049889361 9:54155-54177 ATTATCTGGGAAGAGAGGAGAGG - Intergenic
1050041830 9:1503982-1504004 AATGGCTTGGCAGAGGAAAGAGG + Intergenic
1051414885 9:16829002-16829024 GTGGGCTGGGCAGAGCAGAAGGG + Intronic
1051535675 9:18154776-18154798 AATGGGTGGGAAGAAAAGAGTGG + Intergenic
1051607484 9:18929612-18929634 ATTGGGTGGTGAGAGAACAGTGG + Intronic
1051747863 9:20312101-20312123 AATGAAAGGGCAGAGAAGAGAGG + Intergenic
1053211150 9:36229566-36229588 TTTGGCTAAGAAGAGAAGAGTGG + Intronic
1053482161 9:38423925-38423947 ATTGGGTGGGTAGAGAAGGAGGG - Intronic
1053730851 9:41055413-41055435 ATTATCTGGGAAGAGAGGAGAGG - Intergenic
1054697661 9:68376684-68376706 ATTATCTGGGAAGAGAGGAGAGG + Intronic
1054813091 9:69450383-69450405 ACTGGCAGGGCAGAGAAGACAGG + Intronic
1055265677 9:74493515-74493537 ATTGAATGGGAAGAGGAGAGTGG - Intergenic
1055330118 9:75174885-75174907 AGGGGCTGGGAAGAGAAGAAAGG + Intergenic
1055663567 9:78531389-78531411 ACTTGTTGGGTAGAGAAGAGAGG + Intergenic
1056810934 9:89763495-89763517 ATTGGCTAGGCAGAGCTGGGCGG + Intergenic
1057029489 9:91763719-91763741 ATTGGATGGCTAAAGAAGAGTGG - Intronic
1057410557 9:94813566-94813588 ATGGGAGGGGCAGAGCAGAGAGG - Intronic
1057961264 9:99459537-99459559 AATGGCAGAGCAGAGAAGTGGGG + Intergenic
1058002862 9:99884161-99884183 ATAGGCTGGCCAAAGAACAGAGG + Intergenic
1058569471 9:106324967-106324989 TTGGGGTGGGCAGAAAAGAGAGG + Intergenic
1060391713 9:123283238-123283260 AGTGAGTGGGCAGAGTAGAGTGG - Intergenic
1062460159 9:136659595-136659617 GCTGGCTGGGCAGAGAGGCGTGG - Exonic
1186047444 X:5551941-5551963 AAGTGCTGGGTAGAGAAGAGCGG + Intergenic
1186964925 X:14776544-14776566 AGTGCCTGGGCTGAGAAAAGGGG + Intergenic
1187178771 X:16922323-16922345 AGAGGCTGGGAAGGGAAGAGGGG + Intergenic
1188089090 X:25940163-25940185 ATTTGCTGGGGAGAGGAGAAAGG - Intergenic
1189578376 X:42379997-42380019 ATTGGCTTGGAACAGAAGAAAGG + Intergenic
1192605252 X:72509702-72509724 GTTGCCGGGGCAGAGGAGAGGGG + Intronic
1193178636 X:78426324-78426346 AGAGGCTGGGAAGGGAAGAGAGG + Intergenic
1196166664 X:112542610-112542632 ATAGGCTGGGGAGAAAAAAGGGG - Intergenic
1196405725 X:115360625-115360647 TTTGGCTGGACAGAGAAGTTGGG - Intergenic
1196491437 X:116272183-116272205 TTTGGATGGGCAAAGAAGAAAGG - Intergenic
1197287438 X:124612681-124612703 ATTGGGTAGGCAGAGGGGAGAGG + Intronic
1197292042 X:124670462-124670484 AGTGGCTGAGGAGAGTAGAGGGG - Intronic
1197520725 X:127492724-127492746 TTTGGCTGGGGATGGAAGAGAGG + Intergenic
1198049649 X:132938352-132938374 ATAGACTGGGCAGAGAACAGTGG + Intronic
1198087411 X:133294070-133294092 TTTGACTAGGCAGGGAAGAGAGG - Intergenic
1198685110 X:139220576-139220598 TTTGGGTGTGCAGAGAAGTGGGG + Intronic
1198769340 X:140112321-140112343 ACTGGCAGTGCAGAGAAGAGAGG + Intergenic
1198838456 X:140830306-140830328 ACTGGCAGGGCAGAGAGGATGGG + Intergenic
1199712267 X:150477729-150477751 TTTAGGTGGGCAGAGAGGAGGGG + Intronic
1199882458 X:151985345-151985367 ATGGGCTGCACAGAGAAGACAGG + Intergenic
1202234217 Y:22691538-22691560 ATTGGATGGGCAGAGATGTGGGG + Intergenic
1202308942 Y:23504628-23504650 ATTGGATGGGCAGAGATGTGGGG - Intergenic
1202561859 Y:26165960-26165982 ATTGGATGGGCAGAGATGTGGGG + Intergenic