ID: 973992667

View in Genome Browser
Species Human (GRCh38)
Location 4:56426113-56426135
Sequence CCACCGTGCCTGGCAGATAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1075
Summary {0: 1, 1: 0, 2: 17, 3: 177, 4: 880}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973992667_973992672 5 Left 973992667 4:56426113-56426135 CCCGTATCTGCCAGGCACGGTGG 0: 1
1: 0
2: 17
3: 177
4: 880
Right 973992672 4:56426141-56426163 GCCTGTAATCCCAACACTGTGGG 0: 170
1: 19273
2: 250272
3: 273612
4: 170832
973992667_973992676 14 Left 973992667 4:56426113-56426135 CCCGTATCTGCCAGGCACGGTGG 0: 1
1: 0
2: 17
3: 177
4: 880
Right 973992676 4:56426150-56426172 CCCAACACTGTGGGAGGCCAAGG 0: 64
1: 7553
2: 99953
3: 221368
4: 234060
973992667_973992674 8 Left 973992667 4:56426113-56426135 CCCGTATCTGCCAGGCACGGTGG 0: 1
1: 0
2: 17
3: 177
4: 880
Right 973992674 4:56426144-56426166 TGTAATCCCAACACTGTGGGAGG 0: 222
1: 24488
2: 326278
3: 258409
4: 136093
973992667_973992671 4 Left 973992667 4:56426113-56426135 CCCGTATCTGCCAGGCACGGTGG 0: 1
1: 0
2: 17
3: 177
4: 880
Right 973992671 4:56426140-56426162 CGCCTGTAATCCCAACACTGTGG 0: 101
1: 11029
2: 150918
3: 286416
4: 213270
973992667_973992679 30 Left 973992667 4:56426113-56426135 CCCGTATCTGCCAGGCACGGTGG 0: 1
1: 0
2: 17
3: 177
4: 880
Right 973992679 4:56426166-56426188 GCCAAGGCAGGCAGAACACGAGG 0: 12
1: 1321
2: 8005
3: 24690
4: 52049
973992667_973992678 18 Left 973992667 4:56426113-56426135 CCCGTATCTGCCAGGCACGGTGG 0: 1
1: 0
2: 17
3: 177
4: 880
Right 973992678 4:56426154-56426176 ACACTGTGGGAGGCCAAGGCAGG 0: 43
1: 5384
2: 74165
3: 193993
4: 234688

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973992667 Original CRISPR CCACCGTGCCTGGCAGATAC GGG (reversed) Intronic
900664761 1:3807755-3807777 CCACTGTGCCTGGCTGAGACTGG + Intergenic
900807897 1:4779855-4779877 CCACCGTGCCTGGCCTAAAACGG - Intronic
900983896 1:6062023-6062045 CCACCGCGCTTGGCTGACACTGG - Intronic
900994332 1:6112335-6112357 CCCCCGTGCTTGGCAGAGAGAGG - Intronic
901102954 1:6733519-6733541 CCACCGTGCCTGGCTAATTTTGG - Intergenic
901532494 1:9862368-9862390 CCACCGTGCCTGCCCCATCCTGG + Intronic
901663207 1:10811938-10811960 ACACAGTGCCTGGCACATAGTGG + Intergenic
901694791 1:10998912-10998934 CCACCGTGCCTGGCACACTGGGG - Intergenic
901725082 1:11235329-11235351 CCACCGTGCCTGGCCGACTTTGG - Intronic
901856713 1:12049117-12049139 CCACCGCGCCTGGCCAAGACAGG + Intergenic
902152310 1:14453240-14453262 CCACCGTGCCTGGCCAAAATAGG + Intergenic
902342375 1:15792375-15792397 CCACCGTGCCTGGCCCAGGCTGG - Intergenic
902389890 1:16097236-16097258 CCACCTAGCCTGGCTGATAAGGG - Intergenic
902403108 1:16168588-16168610 CCACCGTGCCTGGCAATGCCCGG + Intergenic
902582025 1:17413843-17413865 CCACCGTGCCCGGCTGGTAGGGG - Intronic
902869696 1:19306717-19306739 CCACCATGCCTGGCCCATCCTGG + Intronic
902894124 1:19467161-19467183 CCACCATGCCTGGCAACTACGGG + Intronic
903231179 1:21923117-21923139 CCACCGTGCCCGGCTGAGTCTGG - Intronic
903497974 1:23783740-23783762 CCACCACGCCTGGCCCATACTGG + Intronic
903581048 1:24371298-24371320 CCACCGTACCCGGCTGATACTGG - Intronic
903640502 1:24856723-24856745 CCACCGTGCCCGGCCCAAACTGG + Intergenic
904158827 1:28507062-28507084 CCATCGTGCCTGGCCGATTTGGG + Intronic
904168810 1:28576602-28576624 CCACCGCGCCCGGCCGAGACGGG + Intronic
904208159 1:28868439-28868461 CCAAAGTGCCTGGCACATAGTGG + Intergenic
904228974 1:29050960-29050982 CCACCACGCCTGGCTGATAAAGG + Intronic
904699026 1:32347357-32347379 CCACAGTGCCTGGCCCATAGGGG + Intergenic
904940892 1:34164497-34164519 CCAGCGTGCCTGGCAGAATCAGG + Intronic
905186294 1:36199426-36199448 CCACCGTGCCTGGCCTGGACTGG - Intergenic
905736110 1:40327285-40327307 CCACCGTGCCTGGCCGAGATCGG + Intergenic
906224197 1:44107390-44107412 CCACCGCGCCTGGCTGAGACTGG + Intergenic
906610887 1:47201476-47201498 GCACAGTGCCTGGCACATAGTGG - Intergenic
906783097 1:48590115-48590137 CCACCGCGCCTGGCCGCTACTGG - Intronic
906801018 1:48736994-48737016 CCACCATGCCTGGCTGTCACTGG - Intronic
907428393 1:54395903-54395925 CCACCGCGCCTGGCCGGTAACGG - Intronic
907799147 1:57747520-57747542 CCACCGTGCCTGGCCTACAATGG - Intronic
908005574 1:59724189-59724211 CCACCATGCCTGGCCAACACGGG - Intronic
908754179 1:67452889-67452911 ACACAGTGCCTGGCATATACTGG - Intergenic
908758688 1:67492323-67492345 CCACTGCGCCCGGCAGAAACTGG - Intergenic
908822320 1:68101260-68101282 GCACCATGCCTGGCAGAGAGGGG + Intronic
909053893 1:70800148-70800170 CCACCGTGCCTGGCCAACATTGG + Intergenic
909116283 1:71541250-71541272 GCACAGTGACTGGCATATACAGG + Intronic
909554884 1:76942513-76942535 ACACAGTGTCTGGCACATACAGG - Intronic
909603235 1:77482483-77482505 CCACCGTGCCCGGCCCCTACAGG - Intronic
909613417 1:77577904-77577926 CCACCGTGCCCGGCCGAAACTGG + Intronic
910178106 1:84452908-84452930 CCACCGTGCCTGGCCGAATGTGG - Intergenic
910983168 1:92978507-92978529 CCACCGTGCCCGGCCAATAAGGG + Intergenic
910986226 1:93007598-93007620 CCACCGTGCCTGGCCAAGAGAGG - Intergenic
911282824 1:95952505-95952527 CCACTGTGCCTGGCCCATTCTGG + Intergenic
911616691 1:100020619-100020641 CCACAGTGCCTAGCATATATAGG - Intronic
912929074 1:113940090-113940112 CCACTGTGCCTGGCCCATACTGG + Intronic
913264319 1:117029608-117029630 GCACAGTGCCTGGCACATAGGGG + Intronic
914622124 1:149420155-149420177 CCACCGTGCCTGGCCGTTTAGGG + Intergenic
914706162 1:150171624-150171646 CCACTGTGCTTGGCAGAGAAGGG - Intergenic
914734524 1:150402677-150402699 CCACCGCGCCCGGCTGAAACGGG - Intronic
914894232 1:151654116-151654138 CCACCGTGCCCGGCCGACCCTGG + Intronic
915178610 1:154038630-154038652 CCACCATGCCCAGCAGACACAGG + Intronic
915424469 1:155813142-155813164 CCACCGTGCCTGGCTGAGAATGG - Intronic
915434202 1:155891200-155891222 CCACCGTGCCCAGCTGATAGTGG - Intergenic
915717844 1:157961379-157961401 CCACCGTGCCTGGCCAATTTTGG - Intergenic
916139761 1:161685407-161685429 CCACTGTGCCTGGGTGATCCTGG - Intergenic
916324655 1:163543285-163543307 ACACAGTGCCTGACACATACGGG - Intergenic
916753957 1:167750487-167750509 CCACCGTGCCTGGCCCACCCAGG + Intronic
917035595 1:170744261-170744283 CCACCGCGCCTGGCCAAGACTGG + Intergenic
917063222 1:171063537-171063559 CCACCGTGCCTGGCCTATCCAGG + Intronic
917203786 1:172546619-172546641 CCACTGTGCCTGGCCTATACAGG - Intronic
917626967 1:176856046-176856068 CCACCGTGCCTGGCACAGGCTGG - Intergenic
917692554 1:177484156-177484178 CCACCATGCCTGTCCGATGCTGG - Intergenic
917928833 1:179810078-179810100 ACACCATGCCTGACACATACCGG - Intronic
918272117 1:182912152-182912174 CCACCGTGCCTGGCGGAATCTGG - Intronic
918296008 1:183158066-183158088 CCACTGTGCCTGGCCGTCACTGG - Intergenic
918491936 1:185090205-185090227 CCATCGTGCCTGGCCGAGGCTGG + Intronic
918731311 1:188000884-188000906 CCACCGCGCCCGGCCGATAATGG - Intergenic
919069562 1:192736556-192736578 CCACCATGCCTGGCTGAGACTGG + Intergenic
919406644 1:197193248-197193270 CCACCGTGCCTGGCTGTGCCAGG - Intronic
919905946 1:202078380-202078402 CCACCCTGCCAGTCACATACAGG + Intergenic
920005686 1:202832225-202832247 CCACCATGCCTGGCTGCTACTGG - Intergenic
920442774 1:205992412-205992434 ACACTGTGCCTGGCACATAGTGG + Intronic
920537462 1:206747907-206747929 CCACCATGCCTGGCCTAAACTGG + Intergenic
920595314 1:207263425-207263447 CCACCGTGCCTGGTTGAAAAGGG + Intergenic
920914587 1:210249927-210249949 CCATCGTGCCTGGCCTAAACAGG - Intergenic
921118280 1:212114841-212114863 CCACCGCGCCCGGCCGATACAGG + Intergenic
921620714 1:217323487-217323509 CCACCGTGCCTGGCCAAGTCAGG - Intergenic
921870848 1:220138183-220138205 CCACCATGCCTGGCCAACACAGG - Intronic
922290625 1:224206355-224206377 CCACCATGCCTGGCTAATTCTGG + Intergenic
922375932 1:224965802-224965824 CCATGGTGCCTGGCAGGTAGTGG + Intronic
922435484 1:225601231-225601253 CCACCGTGCCTGGCCGTAATTGG - Intronic
922440276 1:225650561-225650583 CCACGGTGCCTGGCCGAAAGTGG - Intronic
922506310 1:226127987-226128009 CCACCCTGCCAGGAAGACACAGG - Intergenic
922641193 1:227233644-227233666 CCACCGTGCCTGGCCCAAAATGG - Intronic
922701617 1:227764479-227764501 CCACCGTGCCCAGCCGACACAGG - Intronic
922812465 1:228425184-228425206 CCACCGTGCCGGGCCGGTAGCGG + Exonic
922846213 1:228687025-228687047 CCACCGTGCCTGGCCGGCAAGGG + Intergenic
922905962 1:229173980-229174002 CCATCGTGCCTGGCTGAAGCTGG - Intergenic
924222022 1:241887332-241887354 CCACCTTGCCTGGCCTACACTGG + Intronic
924290409 1:242530179-242530201 CCACCATGCCTGGCCGGCACTGG + Intergenic
924440360 1:244080772-244080794 CCACCGTGCCGGTCAGAGACAGG - Intergenic
924544658 1:245015421-245015443 CCACCGCGCCCGGCAGATTCTGG - Intronic
924758077 1:246959711-246959733 CCACCGTGCCTGGCCCAAAATGG + Intronic
924761049 1:246986353-246986375 CCACCGTGCCTGGCACCAAAAGG + Exonic
1062870185 10:894895-894917 CCACCGTGCCTGGCTTATTGTGG - Intronic
1063590828 10:7394148-7394170 CCACCATGTCTGGTAGAGACGGG + Intronic
1063657219 10:8003756-8003778 CCACTGTGCCTGGCCAAGACTGG - Intronic
1063665893 10:8060385-8060407 CCACGGTGCCTGGCAGGGGCTGG + Intronic
1063680010 10:8177997-8178019 CCACTGTGCCTGGCTAATAAAGG + Intergenic
1063701192 10:8386931-8386953 CCACCATGCCTGGCCTATGCAGG + Intergenic
1064050131 10:12052784-12052806 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1064269532 10:13852394-13852416 CCACCATGCCTGGTAGAGACAGG + Intronic
1064577559 10:16761567-16761589 CCACCGTGCCCGGCTGAGAATGG - Intronic
1064612177 10:17114954-17114976 CCACCGTGCCCGGCCGAAATGGG - Intronic
1064692791 10:17934981-17935003 CCACCGCGCCCGGCCGATAAAGG - Intergenic
1064790142 10:18949830-18949852 CCACCATGCCTGGCCAAAACAGG + Intergenic
1065278354 10:24109116-24109138 CTACCGTGCCTGGCCAAGACTGG + Intronic
1066253592 10:33656940-33656962 CCACCATGCCTGGCTGAGATTGG + Intergenic
1066384283 10:34929017-34929039 CCACCATGCCTGGCCCATACTGG + Intergenic
1066577629 10:36843831-36843853 CCACCGTGCCTGGCCTTTATGGG + Intergenic
1067096936 10:43307606-43307628 CCACCATGCCTGGCCAAAACTGG - Intergenic
1069689375 10:70339831-70339853 CCACCATGCCTGGCCGATGTTGG - Intronic
1070507900 10:77131675-77131697 CCACCGTGCCTGGCAACAGCTGG - Intronic
1070912239 10:80128688-80128710 CCACCATGCCTGGCCAATAATGG + Intergenic
1070978280 10:80623200-80623222 CCGCCGTGCCTGGCCGAAACTGG + Intronic
1071816434 10:89236984-89237006 CCACCGTGCCTGGTCTATATTGG - Intronic
1072049493 10:91689305-91689327 CCACCGTGCCTGGCCTACAAAGG - Intergenic
1072106880 10:92282961-92282983 CCACTGTGCCTGGCTGATTTAGG - Intronic
1072143185 10:92608722-92608744 CCACCGTGCCTGGCCGAACTTGG + Intronic
1072143914 10:92616122-92616144 CCACTGTGCCCGGCTGATATAGG + Intronic
1072157282 10:92735441-92735463 CCACCATGCCTGGCAGATTTTGG + Intergenic
1072159032 10:92749322-92749344 CCACTATGCCTGGCCGAAACTGG + Intergenic
1072193142 10:93092434-93092456 CCACCATGCCTGGCACATAAAGG + Intergenic
1072213191 10:93265484-93265506 CCACCGTGCCTGGCCTATAACGG + Intergenic
1072470673 10:95710115-95710137 CCACCGTGCCTGGCCTATCATGG - Intergenic
1073237158 10:102026944-102026966 CCACAGTACCTGGCATATAGGGG + Intronic
1073306665 10:102508259-102508281 CCACCGTGCCCGGCCAAAACAGG + Intronic
1073329148 10:102659602-102659624 CCACCGCGCCTGGCAGGAATGGG - Intergenic
1073543979 10:104333919-104333941 GCACCGTGCCTGGCGCAGACTGG - Intronic
1073771074 10:106736479-106736501 CCAAAGTGCCTGGCAGGTATTGG + Intronic
1074052663 10:109894242-109894264 CCACTGTGCCTGGCTGAAAGGGG - Intronic
1074144006 10:110700726-110700748 CCACCGTGCCTGGCCCAAAGAGG - Intronic
1074785133 10:116832451-116832473 CCACCGTGCCTGGCTGCAAAGGG + Intergenic
1074892290 10:117745755-117745777 CCACCTTCCCTGGAAGACACAGG + Intergenic
1075049885 10:119175680-119175702 CCACAGTGCCTGGCTGAGATGGG + Intronic
1075113116 10:119603980-119604002 CCACCATGCCTGGCCTAGACTGG + Intergenic
1075391607 10:122096407-122096429 CCACCGCGCCTGGCCGGTAAGGG - Intronic
1075702570 10:124478760-124478782 CCACCGCGCCTGGCCCAAACTGG - Intronic
1075761004 10:124856562-124856584 CCACCGTGCCTGGCCAACTCTGG + Intergenic
1075779561 10:125008232-125008254 CCACCGTGCCTGGCCGGCTCTGG + Intronic
1075866062 10:125719986-125720008 CCACGGTTCCCGGCAGATTCTGG + Intronic
1076110747 10:127857246-127857268 CCATGGTGCCTTGCAGATGCTGG + Intergenic
1077274758 11:1699308-1699330 CCACCGCGCCCAGCAGAGACGGG + Intergenic
1078109373 11:8380270-8380292 CCACTGTGCCTGGCCAATAATGG - Intergenic
1078269974 11:9786146-9786168 CCACTGCGCCTGGCAGACACTGG + Intronic
1078697244 11:13646796-13646818 CCACCTTGCCTGGCTGAAAAAGG + Intergenic
1078747892 11:14132641-14132663 CCACTGTGCTTGGCACATAATGG + Intronic
1079296931 11:19242045-19242067 GCCCCGTGCCTCGCAGAAACTGG + Intergenic
1079948359 11:26770597-26770619 CCACCATGCCCAGCTGATACTGG + Intergenic
1080104913 11:28501810-28501832 CCACCGCGCCTGGCCGAGCCAGG - Intergenic
1080127856 11:28758640-28758662 CCACCGTGCCCAGCTGATATTGG - Intergenic
1080173536 11:29335057-29335079 CCACAGAGACTGGCAGATACAGG + Intergenic
1080472745 11:32561887-32561909 CCACCGCGCCCGGCCGATGCTGG + Intergenic
1080518442 11:33045065-33045087 CCACCATGCCTGGCCAATCCTGG - Intronic
1080549360 11:33358310-33358332 GCACAGTGCCTGGCATATAGTGG + Intergenic
1081054462 11:38391119-38391141 CCACCGTGCCTGGCCTATCAAGG + Intergenic
1081112678 11:39156118-39156140 CCACCGTGCCCGGCCAACACAGG + Intergenic
1081622270 11:44625616-44625638 CCACAGTGCCTGGCATAGAGTGG - Intergenic
1081771621 11:45653729-45653751 GAACAGTGCCTGGCACATACAGG - Intronic
1081890736 11:46540117-46540139 CCACCGTGCCCGGCAGTAACTGG + Intronic
1082593884 11:55050256-55050278 CCACCGTGCCTGGCCAAAAAAGG - Intergenic
1082857410 11:57820742-57820764 CCACCATGCCTGGCCCATCCAGG + Intergenic
1083224232 11:61274490-61274512 CCACCATACCTGGCAAACACAGG + Exonic
1083275188 11:61593026-61593048 CCACCGTGCCTGGCCCACAATGG + Intergenic
1083283313 11:61641009-61641031 CCACCGTGCCCGGCCACTACAGG - Intergenic
1083554684 11:63616694-63616716 CCACCGCGCCCGGCCTATACTGG - Intronic
1083641142 11:64146055-64146077 CCACCGTGCCTGGCCAAGAATGG + Intronic
1083686912 11:64382032-64382054 CCACCGTGCCCGGCACCCACAGG + Intergenic
1083937211 11:65876093-65876115 CCACCGTGCCTGGCCTATTGTGG - Intergenic
1084053295 11:66615212-66615234 CCACCGGGCCTGGCCCATACTGG + Intergenic
1084152320 11:67294795-67294817 CCACCGTGCCTGGCCACTAAGGG + Intronic
1084281398 11:68097345-68097367 CCACCGTGCCCGGCCCACACGGG - Intronic
1084299224 11:68235449-68235471 CCACCGTGCCTGGCCCACAGCGG - Intergenic
1084351254 11:68601442-68601464 CCACACTGCCTGGGAGAGACTGG - Intronic
1084371446 11:68747477-68747499 CCACCATGCCTAGTAGAGACAGG - Intronic
1084377000 11:68784387-68784409 CCACCATGCCTAGTAGAGACAGG - Intronic
1084572800 11:69969659-69969681 CCACCGTGCCTGGCCGCATCCGG - Intergenic
1084726858 11:70947506-70947528 CCACCATGCCTGGCTAATCCTGG + Intronic
1084975021 11:72792340-72792362 CCACCGTGCCTGGCCTATCTGGG + Intronic
1085137190 11:74102318-74102340 ACACATTGCCTGGCACATACTGG - Intronic
1085215097 11:74822755-74822777 GCACAGTGCCTGACAGATAATGG + Intronic
1085282707 11:75341423-75341445 CCACCATGCCTGGCCGACAATGG + Intronic
1085367636 11:75965600-75965622 CCACCGCGCCCGGCAGATGTTGG + Intronic
1085404127 11:76251726-76251748 CCCCAGTTCCTGGCAGCTACTGG - Intergenic
1085482170 11:76831668-76831690 CCACCATGCCCAGCTGATACTGG - Intergenic
1086965120 11:93019405-93019427 CCACCATGCCTGGCCAATATAGG + Intergenic
1087236057 11:95719908-95719930 CCACCGCGCCTGGCCGGCACTGG - Intergenic
1087938326 11:104061893-104061915 CCACCATGCCTGGCCGTTTCTGG + Intronic
1087968119 11:104444380-104444402 CCTGCCTGCCTTGCAGATACAGG - Intergenic
1089381014 11:118031848-118031870 CCACCATGCCTGGCCGATGCTGG - Intergenic
1089481018 11:118805122-118805144 CCACCGTGCCTGGCCAGAACTGG + Intergenic
1089495375 11:118905919-118905941 CCACTGTGCCTGGCAAACATAGG - Intronic
1089590186 11:119535113-119535135 CCACCGCGCCTGGCCCAGACTGG + Intergenic
1089992348 11:122873433-122873455 CCACTGTGCCTGGCATATAATGG + Intergenic
1090587381 11:128228689-128228711 CCACTGTGCCGGGCTGATTCAGG - Intergenic
1091425139 12:381279-381301 CCACCGTGCCCGGCTGAGACAGG + Intronic
1091552683 12:1548737-1548759 CCACCATGCCCGGCTGAGACTGG - Intronic
1092735820 12:11581511-11581533 CCACAGTGCCTGACACATGCTGG + Intergenic
1093748610 12:22772391-22772413 CCACCGTGCCCGGCCAAAACAGG + Intergenic
1093972821 12:25390826-25390848 CCACCGCGCCCGGCTGGTACTGG - Intergenic
1095598967 12:43993329-43993351 GCACAGTGCCTGGCACATAATGG + Intronic
1096092553 12:48912848-48912870 CCACCGCCCCTGGCAGAACCTGG - Intronic
1096168827 12:49449499-49449521 CCACCGTGCCTGGCCCAGTCTGG + Intronic
1096523995 12:52199935-52199957 GCACGGTGCCTGGCATATAGTGG + Intergenic
1096806152 12:54142367-54142389 CCACTGTGCCTGGCCGAGCCTGG - Intergenic
1096940214 12:55336161-55336183 CCACCCTGCCTTGCATATAATGG - Intergenic
1097346587 12:58499973-58499995 GCACCATGTCTGGCACATACAGG - Intergenic
1097865347 12:64555460-64555482 CCACCGTGCCCGGCCGGTAGAGG - Intergenic
1098391586 12:69975312-69975334 CCACAGGGCCTGGCAAATTCTGG - Intergenic
1100004605 12:89879562-89879584 ACACAGTACCTGGCAGATAGGGG + Intergenic
1100438565 12:94594378-94594400 CCACCGTGTCTGGCAGAACCAGG + Intronic
1100627946 12:96355691-96355713 CCAACGTGCCCGGCATATATTGG + Intronic
1101006172 12:100403187-100403209 CCACCACGCCTGGCAGAAAGAGG - Intronic
1101145671 12:101838406-101838428 CCACCGTGCCTGGCAGAAGCTGG - Intergenic
1102004490 12:109580619-109580641 CCACCCAGCCTGGAAGATTCTGG - Intronic
1102087269 12:110152876-110152898 CCACCATGCCTGGCTTATTCGGG + Intronic
1102091407 12:110191881-110191903 CCACCGTGCCTGGCCTGAACAGG - Intronic
1102105033 12:110314000-110314022 CCACTGTGCCCGGCCGATAATGG + Intronic
1102299284 12:111759290-111759312 CCACCGTGCCCAGCAGGGACAGG + Intronic
1102365913 12:112334505-112334527 CCACCGTGCCTGGCCGATTATGG - Intronic
1102662020 12:114537400-114537422 CCACCTTGCCTGGCCAACACTGG + Intergenic
1103025526 12:117570968-117570990 CCACCGTGCCTGGCTGGAATAGG - Intronic
1103523676 12:121552943-121552965 CCACCGTGCCCGGCTGGTACTGG - Intronic
1103673973 12:122641340-122641362 CCACCGTGCCTGGCCTATCCCGG + Intergenic
1103784237 12:123420310-123420332 CCACTGCGCCTGGCAGAGACGGG + Intronic
1104156600 12:126139008-126139030 CCATAGTGCATGGCAGATAATGG - Intergenic
1104471838 12:129035661-129035683 CCACCGTGCCTGGCCAGCACTGG + Intergenic
1104547189 12:129723027-129723049 CCACTGTGCCCGGCCGATCCTGG + Intronic
1104739538 12:131163225-131163247 CCCCCGTGCCTGGGTGACACTGG - Intergenic
1104849508 12:131864894-131864916 CCACCACGCCTGGCTAATACGGG - Intergenic
1106052686 13:26206294-26206316 CCACCCTGCCAGGCAGATGGTGG - Intronic
1108293699 13:48990035-48990057 CCACCGTGCCTGGCCCATAAAGG + Intronic
1108705729 13:52984076-52984098 TCACCTTGTCTGGCACATACTGG + Intergenic
1109584350 13:64378482-64378504 CCACAGTGCCTGGCTGATGTAGG - Intergenic
1110527047 13:76550436-76550458 CCACCGTGCCTGGCCAGTATAGG - Intergenic
1111491487 13:88981854-88981876 CCACGGAGCCTGGGAGATAGAGG + Intergenic
1111795874 13:92918968-92918990 CCACCGTGCCTGGCCACTAATGG + Intergenic
1112124486 13:96449247-96449269 CCACTGTGCCTGGCATAATCTGG + Intronic
1112133122 13:96545956-96545978 GCACAGTGCCTGGCACATAGTGG + Intronic
1112202123 13:97286939-97286961 TCCCTGTGCCTGGCAGCTACTGG + Intronic
1113369751 13:109712996-109713018 CCACCGTGCCTGGCCCATCTGGG - Intergenic
1113930908 13:113968376-113968398 CCACCGTCCCGGGCAGGTCCAGG + Intergenic
1114214976 14:20650464-20650486 CCACCGTGCCTGGCCACCACTGG - Intergenic
1114234295 14:20811327-20811349 CCACCGTGCCTGGCCCTGACTGG - Intergenic
1114313815 14:21491648-21491670 CCACCGCACCTGGCAGATTAGGG + Intronic
1114891218 14:26926033-26926055 CCAGCGGACCTGGCAGAGACTGG + Intergenic
1115234946 14:31200356-31200378 CCACCGTGCCTGGCCAAGAAAGG - Intronic
1115491249 14:33960324-33960346 CCACCGCGCCCGGCCGAGACAGG - Intronic
1116171771 14:41411726-41411748 CCACCGTGCCTGGTCGAAAATGG - Intergenic
1116479192 14:45377609-45377631 CCACTTTGCCTTGCATATACTGG + Intergenic
1117651663 14:57914274-57914296 CCACCATGCCCGGCTGAGACTGG - Intronic
1117789807 14:59328515-59328537 GCACAGTGCCTGACACATACAGG - Intronic
1119330947 14:73793194-73793216 CCACCGTGCCTGGCTGGTTGTGG - Intergenic
1119349860 14:73955238-73955260 CCACCGCGCCCGGCAGAAGCTGG + Intronic
1119643982 14:76335322-76335344 ACACAGTGCCTGGTATATACTGG - Intronic
1119672295 14:76528939-76528961 CCACTGTGCCCGGCCGAAACAGG + Intergenic
1120127137 14:80758232-80758254 CCACCATGCCTGGCAGGTTAAGG - Intronic
1120253392 14:82088421-82088443 CCACTATGCCTGGCTGAGACTGG + Intergenic
1120517299 14:85485968-85485990 CCACCGTGCCCGGCCTATATAGG + Intergenic
1120788875 14:88561467-88561489 CCACTGTGCCTGGCTTTTACTGG + Intergenic
1121208886 14:92191583-92191605 CAACAGTGCCTGGCACATAGTGG - Intergenic
1121402810 14:93695737-93695759 CCACCATGCCTGGCTGATGTTGG - Intronic
1121644023 14:95505400-95505422 CCACCTGGCCTGGCAGAGAGTGG - Intergenic
1122225334 14:100273439-100273461 CCACCATGCCTGGCTGATTTTGG + Intronic
1122269988 14:100564724-100564746 CCACAGTGCCTGGCAGAGGCTGG - Intronic
1122497200 14:102166150-102166172 CCACCACGCCTGGCAGAGACCGG + Intronic
1122560938 14:102613841-102613863 CCACCGCGCCTGGCTGAGATAGG + Intronic
1122750910 14:103932269-103932291 GCACGGTGCCTGGCACATAGTGG + Intronic
1122873287 14:104651126-104651148 CCACTGTGCCCGGCAGATGCTGG - Intergenic
1123037391 14:105477077-105477099 CCACCCTGCCCGGCAGAATCTGG - Intronic
1123139436 14:106061109-106061131 CCACGGTGGATGGCAGATGCAGG + Intergenic
1123446503 15:20334621-20334643 CCACCGTGCCTGGCCAATGTTGG + Intergenic
1123698969 15:22900685-22900707 CCACCGTGCCTGGCCGAGCCTGG + Intronic
1124794141 15:32760447-32760469 CCACCGTGCCTGGCCCATCCTGG + Intergenic
1124984521 15:34593089-34593111 CCACCGTGCCCGGCCAATATTGG + Intergenic
1125630846 15:41145801-41145823 CCACCATGCCTGGCCGAGCCTGG - Intergenic
1125768026 15:42147901-42147923 CCACTGTGCCTGGCTGAAAATGG - Intronic
1125870666 15:43099047-43099069 CCACCGTGCCTGGGCTATAGGGG - Intronic
1125928936 15:43585901-43585923 CCACCGTGCCTGGCCGAAACAGG - Intronic
1125942103 15:43685736-43685758 CCACCGTGCCTGGCCGAAACAGG - Intergenic
1126347727 15:47714879-47714901 CCACAGTGCCTGGCATTTAATGG - Intronic
1126609188 15:50511707-50511729 CCACAGTGCCTGGCCTATTCTGG - Exonic
1126746816 15:51834541-51834563 CCACTGTGCCTGGCCGAGAAAGG - Intronic
1127261943 15:57332770-57332792 CCACGGGGCCTGGCATATATGGG + Intergenic
1127360495 15:58240873-58240895 CCACCATGCCTGGCCGACCCAGG - Intronic
1127560783 15:60134087-60134109 CCACCGTGCCCGGCATTTTCTGG - Intergenic
1127822097 15:62667251-62667273 CCACCGTGCCTGGCGAACACTGG + Intronic
1127902295 15:63349814-63349836 CCACAGTGCCTGGCACAGAGTGG + Intronic
1127940421 15:63689874-63689896 CCACCGTGCCTGGCTTCTAATGG - Intronic
1127985436 15:64066817-64066839 CCACTGTGCCTGGCCTCTACTGG - Intronic
1128299463 15:66556590-66556612 CCACCGTGCCCGGCTGACAATGG + Intronic
1128398168 15:67250462-67250484 CCACCATGCCTGGCACATGGAGG + Intronic
1128630455 15:69260545-69260567 CCACCGTGCCTGGCCACAACTGG + Intronic
1129106317 15:73309782-73309804 CCTCAGTGCCTGGCATATAGTGG - Intergenic
1129414098 15:75365435-75365457 CCACCGTGCCCGGCTCATCCCGG - Intronic
1129436789 15:75547951-75547973 CCACCATGCCTGGCCCCTACTGG + Intronic
1129570342 15:76676110-76676132 CCACTGTGCCCGGCTGAAACTGG + Intronic
1129693748 15:77728876-77728898 GCACAGTGCCTGGCACATAGCGG + Intronic
1129785955 15:78310246-78310268 CCACCGTGCCTGGCCAAGACTGG + Intergenic
1129991887 15:79972505-79972527 CCACCGTGCCTGGCCCAAAGAGG - Intergenic
1130001865 15:80054792-80054814 CCACCGCGCCTGGCCGAGGCTGG + Intergenic
1130212046 15:81933213-81933235 CCACCGTGCCTGGCCCAGAAAGG + Intergenic
1130320107 15:82834321-82834343 CCACCGTGCCTGGCTGATGCTGG + Exonic
1131199066 15:90381093-90381115 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1132065005 15:98723718-98723740 TCCCCGGGCCTGGAAGATACTGG + Intronic
1132118194 15:99153084-99153106 CCACCGTGCCTGGCCAGCACTGG + Intronic
1132235228 15:100215103-100215125 GCACTGTGCCTGGCAGGTTCCGG + Intronic
1132342210 15:101085907-101085929 CCACCGCGCCTGGCTGATAATGG + Intergenic
1132491166 16:232167-232189 CCACCGTGCCTGGCCAAGACAGG - Intergenic
1132499208 16:277357-277379 CCACTGTGCCTGGCCGATTTTGG + Intronic
1132533317 16:464606-464628 CCACTGTGCCTGGCCCATAATGG - Intronic
1133124205 16:3634513-3634535 CCACTGTGCCTGGCCGAGACAGG + Intronic
1133300733 16:4780971-4780993 CCACCGTGCCCAGCAGAGACAGG - Intronic
1133305764 16:4807398-4807420 CCACCGTGCCCAGCTGAAACTGG + Intronic
1133344139 16:5058950-5058972 CCACCGCGCCTGGCTGGTGCAGG - Intronic
1133513086 16:6479760-6479782 CCACCGTGCCTGGCCTAGACTGG - Intronic
1134170823 16:11968187-11968209 CCACCGCGCCTGGCCAAAACTGG - Intronic
1134180763 16:12045909-12045931 CCACCGTGCCTGGCCAAGGCAGG + Intronic
1134415941 16:14043444-14043466 CCACAGTGCATGCCAGACACAGG - Intergenic
1134587064 16:15420861-15420883 CCACTGTGCCTGGCCCAGACAGG + Intronic
1134751469 16:16628663-16628685 CCACCGTGCCTGGCCTGTACAGG - Intergenic
1134993992 16:18724944-18724966 CCGCCGTGCCTGGCCTGTACAGG + Intergenic
1135027126 16:19007110-19007132 CCACCGTGCCTGGCTGTCCCAGG + Intronic
1135094448 16:19553756-19553778 CCACCATGCCTGGCTAATATCGG - Intergenic
1135234460 16:20742368-20742390 CCACCGTGCCCGGCCGACCCTGG - Intronic
1135246489 16:20861502-20861524 TCACAGTGCCTGGCACATGCTGG + Intronic
1135307511 16:21379672-21379694 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1135333835 16:21584228-21584250 GCACCGTGCCTGGCCGAAGCAGG - Intergenic
1135408796 16:22217738-22217760 CCACCGTGCCTGGCTGGTTTGGG + Intronic
1135667878 16:24351281-24351303 CCACCATGCCTGGCTGAAACTGG - Intronic
1135996359 16:27252367-27252389 CCACCGTGCCTGGCCATTCCTGG - Intronic
1136099794 16:27985554-27985576 CCACCGTGCCCGGCCGAGACTGG - Intronic
1136291406 16:29274503-29274525 CCACTGTGCCTGGCAGCTGGGGG - Intergenic
1136304256 16:29358792-29358814 CCACCGTGCCTGGCCAAGGCAGG + Intergenic
1136385814 16:29925538-29925560 CCACAGCGCCTGGCAGTTAGGGG + Intronic
1136445288 16:30313769-30313791 CCACCACGCCTGGCTGATATTGG - Intergenic
1136473678 16:30498609-30498631 CCACCATGCCTGGCCAATAATGG - Intronic
1137013636 16:35349968-35349990 CCACCGCGCCCGGCCGATATTGG - Intergenic
1137622687 16:49886608-49886630 CAACCGAGCCTGGCAGACCCGGG - Intergenic
1137630182 16:49937775-49937797 CCACCATGCCTGGCCAATCCAGG + Intergenic
1138084024 16:54117265-54117287 CCACAGTACCTGACATATACTGG + Exonic
1138092106 16:54183160-54183182 CCACCGTGCCTGGCTCATGTTGG + Intergenic
1138489732 16:57369736-57369758 CCACATTGCCTGGCACACACCGG + Intergenic
1138500930 16:57443736-57443758 CCACCGTGCCTGGCCAATTTTGG + Intronic
1138674317 16:58640032-58640054 CCACCGTGCCTGGCCCGTAGAGG + Intergenic
1138682689 16:58697532-58697554 CCACAGCGCCTGGCGGGTACTGG - Intergenic
1139185477 16:64801084-64801106 CCACCGCGCCCGGCCGAGACAGG + Intergenic
1139438659 16:66952406-66952428 CCACCGTGCCTGGCCGAAACCGG - Intergenic
1139460885 16:67121487-67121509 CCACCGTGCCTGGCCAAGAGTGG + Intronic
1139604351 16:68007491-68007513 CCACCGCGCCTGGCCGAGACAGG + Intronic
1139848279 16:69935562-69935584 CCAGCGTGCGGGGCAGATGCGGG + Intronic
1139946643 16:70646745-70646767 CCACGCTGCCGGGCAGATAAGGG + Exonic
1139973346 16:70790192-70790214 CATCCCTGCCTGGCAGACACGGG - Intronic
1140350218 16:74255524-74255546 CCACCGCGCCCGGCAGAAAAAGG - Intergenic
1141420205 16:83909920-83909942 CCACCGTGCCCGGCTGATATAGG + Intronic
1141520787 16:84577530-84577552 CCACCATGCCTGGCCGGAACAGG + Intronic
1142097280 16:88248422-88248444 CCACTGTGCCTGGCAGTTGGGGG - Intergenic
1142360997 16:89626828-89626850 CCACCGCGCCTGGCCAAGACTGG - Intronic
1142571025 17:874300-874322 CCACCGTGCCCGGCTGAGACTGG - Intronic
1142635423 17:1254144-1254166 CCACCGCGCCTGGCGGACATTGG - Intergenic
1142732400 17:1869247-1869269 CCACCATGCCCGGCCGAAACAGG - Intronic
1142874187 17:2841591-2841613 CCACCGTGCCCGGCCGATTTGGG + Intronic
1143025419 17:3938822-3938844 CCACCGTGCCCGGCCAAGACTGG + Intronic
1143122001 17:4613972-4613994 CCACCGTGCCTGGCCTATGCAGG - Intergenic
1143156682 17:4841812-4841834 CCACCGTGCCCAGCATATACTGG - Intronic
1143221689 17:5267336-5267358 CCACCGTACCTGGCCGACAGAGG - Intergenic
1143236989 17:5411274-5411296 CCACCGTGCTTGGCCAATATTGG - Intronic
1143580037 17:7820094-7820116 CCACCACGCCTGGCAAAAACTGG + Intronic
1143685955 17:8515829-8515851 CCACCGTGCCTGGCCGGGATTGG + Intronic
1143743250 17:8969665-8969687 CCACTGTGCCTGGCTGACATTGG + Intergenic
1143900807 17:10173479-10173501 CCACCGCGCCTGGCCGAGAGAGG - Intronic
1143919252 17:10317952-10317974 CCACTGTGCCTGGCCGATTGGGG - Intronic
1144087464 17:11823642-11823664 CCACCGTGCCCGGCCGACAGGGG - Intronic
1144696546 17:17307566-17307588 CCACCGTACCTGGCTGAGGCAGG - Intronic
1145350941 17:22082616-22082638 TCACCGTGCCTGGCAAATTATGG + Intergenic
1145373999 17:22330763-22330785 CCACTGTGCCTGGCCAATAGAGG + Intergenic
1145945284 17:28769466-28769488 CCACCGTGCCTGGCCCAAACGGG + Intronic
1146530843 17:33606644-33606666 GCATAGTGCCTGGCAGATCCTGG + Intronic
1146568465 17:33933385-33933407 CCGCAGTGCCTGGCACATACTGG + Intronic
1146590044 17:34121025-34121047 CCACCGTGCCTGGCCAGTACTGG + Intronic
1146754954 17:35421825-35421847 CCACCGCGCCTGGCCGAGGCAGG + Intronic
1146898996 17:36569038-36569060 CCACCGTGCCTGGCCTACAAAGG + Intronic
1146943834 17:36861082-36861104 CCACCGTGCCTGGCCGACCCAGG + Intergenic
1147114037 17:38285445-38285467 CCACCGTGCCCAGCTGAGACTGG + Intergenic
1147263330 17:39221384-39221406 CCACCGCGCCTGGCCAAGACTGG + Intronic
1147609182 17:41791760-41791782 CCACCATGCCTGGCCGATCCTGG + Intergenic
1147687931 17:42298446-42298468 CCACCGAGCCTGGCACATGATGG + Intronic
1147759193 17:42786678-42786700 CCACCGTGCCTGGCCGAGTATGG + Intronic
1147983590 17:44290842-44290864 CCACCGCACCTGGCTGAGACGGG + Intergenic
1148415568 17:47503745-47503767 CCACCGTGCCCAGCTGAGACTGG - Intergenic
1148434087 17:47667843-47667865 CCACCGCGCCTGGCCGATTTTGG + Intronic
1148493784 17:48039832-48039854 CCACCGTGCCCGGCCGACACTGG - Intergenic
1148496833 17:48058116-48058138 CCACCAGGCCTGGCAGAGATGGG - Intronic
1148639712 17:49177706-49177728 CCACTGTGCCCGGCAGAATCTGG - Intergenic
1148800608 17:50222751-50222773 CCACCGTGCCTGGCAAATCTTGG - Intergenic
1148878986 17:50710946-50710968 CCACCGTGCCTGGCCAGCACTGG - Intergenic
1148928215 17:51106507-51106529 CCACCGCGCCTGGCAGAACAAGG - Intronic
1149207357 17:54264133-54264155 CCACCGCTCCTGGCCGATATGGG - Intergenic
1149413754 17:56436534-56436556 CCACCGTGCCCGGCCGCAACTGG - Intronic
1149537805 17:57445947-57445969 GAACAGTGCCTGGCAGAGACAGG - Intronic
1149607642 17:57936134-57936156 CCACAGGGCCTGACAGATTCAGG - Intronic
1149657908 17:58319901-58319923 CCGCCGTGTCTGTCAGACACTGG - Intronic
1149749993 17:59136449-59136471 CCACTGTGCCTGGCCAGTACTGG + Intronic
1149825335 17:59823160-59823182 CCACCATGCCTGGCCCATTCAGG - Intronic
1149981162 17:61312482-61312504 CCACTGTGGCTGGCACAAACAGG + Intronic
1150288478 17:63967438-63967460 CCACCGTGCCTGGCACTTTAGGG + Intronic
1150328193 17:64273628-64273650 CCACCGGGCCCGGCCGATCCTGG - Intergenic
1150526594 17:65929710-65929732 TCACAGTGCCTGGCACATACAGG + Intronic
1150625058 17:66836124-66836146 CCGGCGTGCCTGGCAGGTACCGG - Intronic
1150701614 17:67451921-67451943 CCACCACGCCTGGCCGAGACTGG + Intronic
1150774622 17:68069484-68069506 CCACCGTGCCTGGCTCAACCTGG + Intergenic
1151229111 17:72669704-72669726 CCACCGCACCTGGCTGATATTGG - Intronic
1151483081 17:74381703-74381725 CCACCGTGCCTGGACGAAGCTGG - Intergenic
1151671159 17:75572374-75572396 CCACCGCGCCTGGCCCATGCCGG - Intronic
1152258870 17:79255821-79255843 CCACCGTCCCTGGGATGTACAGG - Intronic
1152582791 17:81174660-81174682 CCACCGCGCCTGGCAAACAGAGG - Intergenic
1152612181 17:81321226-81321248 CCACCGCGCCTGGCCGTCACTGG - Intronic
1152765887 17:82138433-82138455 CCACCGCACCTGGCTGAGACGGG + Intronic
1152919862 17:83060823-83060845 CCACCGTGCCCGGCCGAGTCTGG - Intergenic
1152987309 18:332540-332562 TCACGGTGCCTGGCATATAGAGG + Intronic
1152993617 18:385608-385630 CCACCGTGCCTGGCCAAAAATGG + Intronic
1153208387 18:2730455-2730477 CCACCGTGCCTGGCCCACAAAGG + Intronic
1153340383 18:3967250-3967272 CCACAGTGCCTGGCAGTGCCTGG - Intronic
1153883334 18:9439549-9439571 CCACCGTGCCTGGCGTTTATTGG - Intergenic
1153930624 18:9875837-9875859 CCACCGTGCCCGGCCGATTATGG - Intergenic
1154985498 18:21546832-21546854 CCACCGTGCCTGGCTGGTTTAGG + Intronic
1155176125 18:23302758-23302780 CCACCCTGGCTGGCTGAGACTGG - Intronic
1155224202 18:23714230-23714252 CCACTGTGCCTGGCCTATTCTGG - Intronic
1155230371 18:23767858-23767880 CCACCGTGCCTGGCAAGGAAAGG + Intronic
1155820439 18:30368955-30368977 CCACTGTGACTGGAAGATAGAGG - Intergenic
1156120008 18:33831914-33831936 CCACCGTGCCTGGCCCAGACAGG - Intergenic
1156242120 18:35264857-35264879 CCACCGTGCCTGGCAAAAATGGG - Intronic
1156393880 18:36680175-36680197 CCACCATCCCTGGCAGCTACAGG - Intronic
1156652295 18:39238619-39238641 CCACCGTGCCTGGCCGAAAATGG + Intergenic
1156746459 18:40397645-40397667 CCATTGTGCCTGGCACATTCTGG - Intergenic
1157220753 18:45827201-45827223 CCACCATGCCCGGCAGAGAAAGG + Intronic
1157512415 18:48286762-48286784 CCACCGTGCCTGGCCTCTTCTGG - Intronic
1157850903 18:51050068-51050090 CCACCGTGCCTGGCTGACAGTGG - Intronic
1157891656 18:51423814-51423836 CCACTGTGCCTGGCCTATTCTGG + Intergenic
1158131017 18:54152748-54152770 GCACAGTGCCTGGCACATAGTGG - Exonic
1158132170 18:54164171-54164193 CCACTGTGTCTGGCAGAAAGAGG + Intronic
1158560993 18:58513587-58513609 CCACCATGCCTGGCAAATTTGGG - Intronic
1159004295 18:62999015-62999037 CAACAGTGCCAGGCAGATAGCGG + Intergenic
1159317222 18:66791559-66791581 CCACCATGCATGACCGATACTGG + Intergenic
1159742541 18:72190410-72190432 CCACCGCGCCTGGCCCATTCTGG + Intergenic
1160445919 18:78926609-78926631 CCACCGTGCCTGGCAATTTCCGG - Intergenic
1160549494 18:79684481-79684503 CCACCCTGCCTGGCTGGTGCTGG - Intronic
1160753155 19:744604-744626 CCACCATGCCTGGCCATTACAGG - Intronic
1161123127 19:2541043-2541065 GCACCCGGCCTGGCAGAGACAGG + Intronic
1161319993 19:3636700-3636722 CCACAGTGCCTGGCACACAGAGG + Intronic
1161373822 19:3928652-3928674 CCACCGTGCCTGGCCGTGAATGG - Intergenic
1161413861 19:4133462-4133484 CCACCGCGCCCGGCTGAGACGGG - Intergenic
1161480359 19:4507282-4507304 CCACCGTGCCCAGCAGTCACAGG - Intronic
1161497798 19:4597166-4597188 CCACCGTGCCCGGCAGCTAATGG + Intergenic
1161610665 19:5240550-5240572 CCACCGTGCCCGGCCGAAAGGGG - Intronic
1161626742 19:5331418-5331440 CCACCATGCCTGGCAAAATCAGG + Intronic
1161645259 19:5449443-5449465 CCACCATGCCTGGCCAAGACAGG + Intergenic
1161797953 19:6398382-6398404 CCACCGCGCCTGGGTGAGACAGG - Intergenic
1161884687 19:6985394-6985416 CCACCGTGCCCGGCTGAGCCAGG - Intergenic
1162025318 19:7890500-7890522 CCACCGTGCCCGGCTGAAGCAGG - Intronic
1162054582 19:8055001-8055023 CCACTGTGCCTGGCTGATAGTGG - Intronic
1162065687 19:8123935-8123957 TCACCCTGCCTGGCAAGTACCGG - Exonic
1162244122 19:9384562-9384584 CCACCATGCCTGGCCGGAACTGG + Intergenic
1162274782 19:9644485-9644507 CCACCGTGCCTGGCCGAGACTGG + Intronic
1162347053 19:10125125-10125147 CCACTGTGCCCAGCAGAAACAGG - Intergenic
1162356225 19:10186683-10186705 CCACCATGCCTGGCTGATTCTGG - Intronic
1162485352 19:10956968-10956990 CCACCGTGCCTGGTTGAGACAGG + Intergenic
1162603546 19:11689299-11689321 CCACCGCGCCTGGCCCAGACTGG - Intergenic
1162706141 19:12555979-12556001 CCACCGTGCCTGGCCTACACAGG - Intronic
1162852218 19:13439696-13439718 CCACCGTGCCTGGCCCAGTCTGG + Intronic
1163041088 19:14603020-14603042 CCACCGTGGCTGGCCAAAACAGG + Intronic
1163166285 19:15500275-15500297 CCACCGTGCCTGGCCTAGGCTGG - Intergenic
1163214028 19:15862977-15862999 ACACCGGGGCTGGCAGACACCGG - Intergenic
1163279104 19:16304280-16304302 CCACCGTGCCTGGCTGACTTTGG - Intergenic
1163332463 19:16649288-16649310 CCACTGCGCCTGGCTGAAACAGG - Intronic
1163411584 19:17158282-17158304 CCACCGTGCCTGGCTGGCAGGGG - Intronic
1163507677 19:17717958-17717980 CCACCGTGCCCGGCAGAGATGGG - Intergenic
1163634053 19:18430308-18430330 CCACAATTTCTGGCAGATACAGG + Intronic
1163859059 19:19731285-19731307 CCACCGCGCCTGGCTGATTGTGG - Intronic
1163984359 19:20931060-20931082 CCACTGCGCCTGGCAGAGATGGG + Intronic
1164103218 19:22077950-22077972 CCACCGTGCCTGGCCTAGAATGG - Intronic
1164145853 19:22512208-22512230 CCACCATGCCTGGCCGAAGCAGG + Intronic
1164924054 19:32112809-32112831 CCACCATGCCTGGCTAACACTGG + Intergenic
1164930939 19:32175413-32175435 CCACCGTGCCTGGCTGATGCTGG + Intergenic
1164947304 19:32307060-32307082 CCACCGTGCCTGGCCCAGACTGG + Intergenic
1164991787 19:32689917-32689939 CCACCACACCTGGCAGAAACTGG - Intergenic
1165224847 19:34347512-34347534 CCACTGTGCCTGGCTGATGCTGG + Intronic
1165740826 19:38204139-38204161 ACACCTTGCCTGTCAGATCCAGG - Exonic
1166021692 19:40037065-40037087 CCACCGTGCCTGGCTAATTTTGG + Intronic
1166138003 19:40789064-40789086 CCACCGCACCTGGCCGACACAGG + Intronic
1166657041 19:44619981-44620003 CCACTGCGCCTGGCCGACACTGG - Intronic
1166706996 19:44913595-44913617 CCACCATGCCTGGCTAATGCAGG + Intergenic
1166709167 19:44926155-44926177 CCACCATGCCTGGCCAATGCAGG + Intergenic
1166946229 19:46398269-46398291 CCACTGTGCCTGGCTGACACTGG - Intergenic
1166986986 19:46666673-46666695 CCACCGCGCCTGGCCGAGACTGG - Intergenic
1167094395 19:47366566-47366588 CCACTGTGCCTGGCTGACACTGG + Intronic
1167176927 19:47871275-47871297 CCACCGTGCCTGGCCAACCCTGG + Exonic
1167326190 19:48827328-48827350 CCACCGTGCCTGGCAAGGACAGG + Intronic
1167376089 19:49112898-49112920 CCACCTTGCCTGGCCGATACTGG - Intergenic
1167628024 19:50605338-50605360 CCACCGTGCCTGGCCAATTTTGG + Intergenic
1167640919 19:50680941-50680963 CCACCACGCCTGGCTGATAGTGG + Intronic
1167899699 19:52610568-52610590 CCACCATGCCTGGCCCATTCTGG + Intronic
1167953596 19:53046878-53046900 CCACCGTGCCCAGCCGATACGGG - Intronic
1168144413 19:54412425-54412447 CCACTGGGCCTGGCCGAGACAGG + Intergenic
1168218841 19:54946076-54946098 CCACCGCGCCCGGCCGAGACAGG + Intronic
1168333209 19:55581199-55581221 ACACAGTGCCTGGCACAGACAGG - Intergenic
1168357435 19:55710796-55710818 CCACCATGCCTGGCAGAGACTGG - Intronic
1168649975 19:58086620-58086642 CCACCCTCCTTGCCAGATACAGG - Intronic
1168663681 19:58186262-58186284 CTACCGTGCCTGGCAGGGACAGG - Intronic
1168713633 19:58515035-58515057 CCACCACGCCTGGCTGAGACAGG - Intronic
925818822 2:7779170-7779192 CCACTGTGCCTGGCCTATTCTGG + Intergenic
925916913 2:8613557-8613579 CCACCGTGCCCGGCCCATAGGGG + Intergenic
925965605 2:9062606-9062628 CCACTGTGCCTGGCTGAGAGGGG - Intergenic
926075970 2:9943109-9943131 CCACCGTGCCTGGCCAAATCAGG - Intergenic
926180217 2:10636173-10636195 CCACCATGCCTGGCCCATCCAGG + Intronic
926189674 2:10719526-10719548 CCACCGTGCCTGGCCTATCCAGG + Intergenic
926356494 2:12045502-12045524 GCACAGGGCCTGGCACATACTGG - Intergenic
926819298 2:16835067-16835089 CCACTGTGCCTGGCTTATCCTGG + Intergenic
927050268 2:19321331-19321353 CCACCGCGCCTGGCCCACACGGG - Intergenic
927179637 2:20435603-20435625 CCACCGTGACTGGCCGAGAGAGG + Intergenic
927512626 2:23653876-23653898 CCACCGTGCCTGGCCGAAGCTGG - Intronic
927541328 2:23913979-23914001 CCACCATGCCTGGTCCATACTGG - Intronic
927544752 2:23942704-23942726 CCACCGTGCCCGGCTGATGCAGG + Intronic
927549517 2:23985666-23985688 CCACCGTGCCCAGCTGATAATGG + Intronic
927657287 2:24959959-24959981 CCACAGGGCCTAGCAGATGCAGG + Intronic
928216661 2:29367152-29367174 GCACAGAGCCTGGCACATACTGG - Intronic
928340496 2:30439317-30439339 CCACCATGCCTGGCTGAGACTGG + Intergenic
928495840 2:31830770-31830792 CCACCATGCCTGGCCGATTTTGG + Intergenic
928851589 2:35754046-35754068 CCACCGTGCCCGGCTGGTACTGG - Intergenic
929714982 2:44301106-44301128 GCACGGAGCCCGGCAGATACAGG + Exonic
929800515 2:45096339-45096361 CCACCATGCCTGGCAGATCAGGG + Intergenic
930007649 2:46910750-46910772 CCACCATGCCTGGCCTATCCTGG - Intronic
930110101 2:47671579-47671601 CCACCATGCCTGGCCAATATAGG + Intergenic
930377565 2:50587195-50587217 CCACCATGCCTGGCCAAAACAGG - Intronic
930377809 2:50589639-50589661 CCACCATGCCTGGCCAAAACAGG + Intronic
930672138 2:54162676-54162698 CCACCATGCCTGGCCTGTACAGG - Intronic
931283138 2:60810896-60810918 CCACCATGCCTGGCCGAGACAGG - Intergenic
931338300 2:61372556-61372578 CCACCATGCCTGGCGGAAACAGG - Intronic
931474333 2:62571986-62572008 CCACCATGCCTGACAAATATGGG + Intergenic
932254855 2:70275809-70275831 CCACCGTGCCTGGCCCATTGGGG - Intronic
932263995 2:70351113-70351135 CCACCGTGCCTGGCTCCTACTGG + Intergenic
932739513 2:74280972-74280994 CCACTGTGCCTGGACTATACAGG + Intronic
932878854 2:75480743-75480765 CCACCGTGCCTGGCCTCTACTGG + Intronic
933182408 2:79242191-79242213 CCACCGCGCCTGGCACATTTGGG + Intronic
933722528 2:85407423-85407445 CCACCATGCCTGGCTGGCACTGG - Intronic
933874037 2:86600672-86600694 CCACCGTGCCTGGCTAAGATGGG - Intronic
934691504 2:96364087-96364109 TCACCGTGCCTGGCTGGTAATGG + Intronic
934696917 2:96406592-96406614 CCACCGCGCCTGGCCGATGGGGG + Intergenic
934853397 2:97715024-97715046 CCACACTGCCCGGCACATACAGG + Intronic
935330846 2:101976609-101976631 CCACGGTCACTGGCAGATTCCGG + Intergenic
935710746 2:105896177-105896199 CCATCGTGCCTGGCTTAAACAGG - Intergenic
936102700 2:109597226-109597248 CCACCGTGCCTGGCTGGAAAAGG + Intronic
936697210 2:114965287-114965309 CCACCATGCCTGGCTGATTTTGG + Intronic
936947221 2:117941630-117941652 CCACCCTGCCAGGCAGGGACAGG + Intronic
937366489 2:121265769-121265791 CCACCGTGCCTGGCCAAGAGTGG + Intronic
937892595 2:126950099-126950121 CCACTGTGCTTGGCCGAGACAGG - Intergenic
937926130 2:127168831-127168853 CCACCGTGCCTGGCCCAGAAAGG - Intergenic
937956867 2:127426608-127426630 CCCCCATGCCTGGCAGAGAGGGG - Intronic
938312722 2:130303742-130303764 CCACCGTGCCTGGCCAATGAAGG - Intergenic
938721279 2:134069265-134069287 CCACCATGCCTGGCTGCCACTGG - Intergenic
939433767 2:142146458-142146480 CCACCGTGCCCGGCTAATTCTGG - Intergenic
940114814 2:150196417-150196439 CCACCGTGCCTGGCCGACGATGG - Intergenic
940229903 2:151439694-151439716 CCACCATGCCTGGCTGAGAATGG - Intronic
940370286 2:152893675-152893697 CCACCGCGCCTGGCCTCTACTGG + Intergenic
940876365 2:158901612-158901634 CCACCGCGCCTGGCCGGTAACGG - Intergenic
942045169 2:172095692-172095714 GCGGCGTGCCTGGCAGATCCTGG + Intergenic
942097429 2:172547210-172547232 CCACCGCGCCTGGCCAAGACGGG + Intergenic
942154052 2:173108416-173108438 CCACCGCGCCCGGCATAAACTGG + Intronic
942566420 2:177268681-177268703 CCACCGCGCCTGGCCTATACTGG - Intronic
942666391 2:178323748-178323770 CCACCATGCCTGGCCGCCACTGG + Intronic
942947838 2:181688745-181688767 GCACAGTGCCTGGCACATAATGG - Intergenic
943248174 2:185483238-185483260 CCACTGAGCCTGGCAGGGACTGG - Intergenic
943807481 2:192140316-192140338 TTATGGTGCCTGGCAGATACAGG + Intronic
944233354 2:197417946-197417968 CCACTGTGCCTGGCCATTACAGG - Intronic
944376971 2:199056915-199056937 CCACCGTGCCTGGCTGATCATGG + Intergenic
944483147 2:200177794-200177816 GCACAGTGCCTGGCATATATTGG + Intergenic
944832162 2:203543757-203543779 CCACCGTGCCTGGCCCAAAAGGG - Intergenic
945854707 2:215055163-215055185 CCACAATTCCTGGCACATACTGG - Intronic
945985238 2:216348324-216348346 CCACCGTGCCTGGCCGGTTAAGG + Intronic
946387808 2:219395896-219395918 CCTCAGTGCCTGGCAGGTAGTGG + Intronic
946667266 2:222064089-222064111 CCACAGTGTCTGGCACATAGAGG - Intergenic
946867241 2:224053102-224053124 CCACCGCGCCTGGCCGATCTTGG - Intergenic
947180668 2:227408526-227408548 CCACCGTGCCTAGCAAAAATAGG - Intergenic
947496686 2:230642940-230642962 TCACCCTGCTTGGCAAATACAGG + Intergenic
947505469 2:230705107-230705129 CCACTGTGCCTGGCAAAGCCTGG + Intergenic
947507947 2:230724392-230724414 CCACCGTGCCCGGCCCATAGAGG - Intronic
947587630 2:231366408-231366430 CCACCGTGCCTGGCCCGTAATGG - Intronic
947738840 2:232475556-232475578 CCACCGTGCCTGGCCGAAGGGGG - Intergenic
947793530 2:232880727-232880749 GCACCGAGCCTGGCAGTCACAGG + Intronic
948009718 2:234641852-234641874 CCACTGTGCCTGGCCAACACTGG - Intergenic
1169438781 20:5616587-5616609 CCACCGTGCCCAGCCAATACAGG + Intergenic
1170297903 20:14849491-14849513 CCACTGTGCCTGGCTGAGAGAGG - Intronic
1171078391 20:22152161-22152183 CCACCGCGCCTGGCAGAATAAGG + Intergenic
1171561193 20:26127572-26127594 TCACCGTGCCTGGCAAATTATGG + Intergenic
1171968465 20:31548576-31548598 GCACAGTGCCTGGCACATAGTGG - Intronic
1172019077 20:31900045-31900067 CCACTGTGCCTGGCCGAATCTGG + Intronic
1172165402 20:32895856-32895878 CCACCGTGCCTGGCCCAGGCTGG + Intronic
1172264468 20:33598971-33598993 CCACCATGCCTGGCCGACAGTGG - Intronic
1172494863 20:35373389-35373411 CCACTGTGCCTGGCCCATTCTGG - Intronic
1172510712 20:35498985-35499007 CCACCGTGCCTGGCCTACCCAGG - Intronic
1172637272 20:36418398-36418420 CCACCGTGCCTGGCCCATTTGGG + Intronic
1172718177 20:36979373-36979395 CCACCATGCCCGGCCGATACAGG + Intergenic
1172985948 20:38989398-38989420 CCACTGTGCCCGGCCGACACAGG + Intronic
1173235229 20:41239294-41239316 CCACCGTGCCTGGCCAATAAGGG + Intronic
1173647699 20:44643852-44643874 CCACGGTGCCTGGCACATAGTGG - Intronic
1173661798 20:44739607-44739629 CCACCGTCCCTGGCCAATTCTGG - Intergenic
1173690507 20:44957343-44957365 CCACCACGCCTGGTAGAGACAGG + Intronic
1174019503 20:47518710-47518732 CCACCATGCCTGGCCAATAGAGG + Intronic
1174219225 20:48939258-48939280 CCACCGCGCCTGGCCTATAGTGG + Intronic
1174327510 20:49791055-49791077 CCACCGTGCCTGGCCCACAAAGG + Intergenic
1174633911 20:51982249-51982271 CCACCGCACCTGGCCGAGACTGG + Intergenic
1174660298 20:52206728-52206750 CCACCATGCCCGGCCGAGACAGG + Intergenic
1174664363 20:52243711-52243733 CCACCGTGCCTGGCAGATGTTGG + Intergenic
1174999395 20:55610086-55610108 CCTCCGTGCCCGGCAGGTAATGG + Intergenic
1175592862 20:60207319-60207341 CCACCATGCCTGGCCGAGACTGG + Intergenic
1175615056 20:60390716-60390738 CAACTGTGCCTGGCACATAAAGG - Intergenic
1175807622 20:61838522-61838544 CCACCGTGCCTGGCCGAGAGAGG - Intronic
1175830268 20:61961106-61961128 CCACCGCGCCTGGCTGATGTCGG + Intronic
1176727059 21:10446480-10446502 CCACTGTGCCTGGCATAGATGGG + Intergenic
1177018134 21:15816842-15816864 CCATCATGCCTGGCAGATTATGG - Intronic
1177175596 21:17698131-17698153 CCACCGTACCTGGCTGCTATTGG + Intergenic
1177194140 21:17884527-17884549 CCACCGCGCCTGGCCGATAATGG + Intergenic
1178173051 21:30063564-30063586 CCAAAGTGTCTGGCAGATAATGG + Intergenic
1178322536 21:31616313-31616335 CCACCGTGCCTGGCCTGTAAAGG + Intergenic
1178549739 21:33526459-33526481 CCACCGTGCCTGGCCTGTAAAGG + Intronic
1178564361 21:33669368-33669390 CCACCATGCCTGGCCCAAACTGG + Intronic
1178628260 21:34236591-34236613 CCACCGTGCCTGGCCCAGATAGG - Intergenic
1178907057 21:36645329-36645351 CCACTGTGGCTGGCCGAGACTGG - Intergenic
1179307155 21:40165120-40165142 CCACCGTGGCTGACAGATGTGGG + Intronic
1179668043 21:42925952-42925974 CCACCGTGCCCGGCTGAGACAGG - Intergenic
1179767953 21:43588088-43588110 CCACCGTGCCGGGCCAGTACTGG - Intronic
1179887463 21:44320312-44320334 CCACTGTGGCTGGCAGGTCCCGG + Intronic
1180163478 21:46008301-46008323 CCACCGTGCGTGGCCAAGACTGG + Intergenic
1180287327 22:10760564-10760586 CCACTGTGCCTGGCATAGATGGG - Intergenic
1180623853 22:17180847-17180869 CCACCATGCCTGGCCTATTCTGG - Exonic
1180667214 22:17523467-17523489 CCACCGTGCCCAGCCGATAAAGG - Intronic
1181302283 22:21889326-21889348 CCACCGCACCTGGCAGAGGCGGG + Intergenic
1181531263 22:23518850-23518872 CCACCGTGCTGGGCAGTGACAGG + Intergenic
1181832953 22:25577460-25577482 CCACCGTGCCTGGCCCGTAAAGG + Intronic
1181872787 22:25913653-25913675 CCATCGTGCCTGGCCGATTGTGG + Intronic
1181898362 22:26131138-26131160 GCACAGTGCCTGGCACATAAAGG + Intergenic
1182196923 22:28528440-28528462 CCACTGTGCCTGGCCTACACTGG - Intronic
1182273260 22:29169233-29169255 CCACCGCGCCTGGCCGACGCTGG - Intergenic
1182377993 22:29862415-29862437 GCACTGTGCCTGGCAGACATAGG + Intergenic
1182846484 22:33435287-33435309 CCACCATGCCTGGCTCCTACGGG + Intronic
1183040885 22:35177090-35177112 ACACAGTGCCTGGCACAGACAGG + Intergenic
1183053995 22:35290356-35290378 CCACCGCGCCTGGCTGGTACAGG - Intronic
1183119155 22:35716547-35716569 CCACCGTGCCTGGCTTCTATTGG + Intergenic
1183399277 22:37592167-37592189 CCACCGTGCCCAGCAGACAATGG + Intergenic
1183399459 22:37593563-37593585 CCACCATGCCTGGCCTATACTGG + Intergenic
1183494394 22:38134272-38134294 CCACCGTGCCTGGCCTAAAGGGG - Intronic
1183610053 22:38894866-38894888 CCACTGTGCCCGGCTGATCCTGG + Intergenic
1183918751 22:41146452-41146474 CCACTGTGCCTGGCCTATAATGG + Intronic
1183925701 22:41204505-41204527 CCACCGCGCCCGGCTGAAACTGG - Intergenic
1183953319 22:41364657-41364679 CCACCGTGCCTGGCCTCTGCAGG - Intergenic
1183961244 22:41413141-41413163 CCACCGTGCCTGGCCGAGGCTGG - Intergenic
1183999236 22:41660139-41660161 CCTCCATGCTTGGCAAATACGGG + Intronic
1184265635 22:43344255-43344277 CCACCGGGCCTGGGAGGGACGGG + Intergenic
1184310212 22:43636409-43636431 ACACAGTGCCTGGCACACACGGG - Intronic
1184336892 22:43859106-43859128 TCACTGTGCCTGGGAGAGACAGG - Intronic
1184361146 22:44019505-44019527 CCACCGTGCCCGGCTGAAGCTGG + Intronic
1184468405 22:44682226-44682248 CCACAGTGCCGGGCAGATTATGG + Intronic
1184578870 22:45398540-45398562 CCACCATGCCCGGCCGATGCAGG - Intronic
1184632748 22:45796784-45796806 CCACTGTGCCTGGCCTATACTGG + Intronic
1184764736 22:46565931-46565953 CCACCGTGCCCGGCTTATATAGG + Intergenic
1184840584 22:47050290-47050312 CCACCGCGCCTGGCCGAGAGGGG + Intronic
1185069558 22:48648551-48648573 CTACTGCGCCTGGCTGATACGGG - Intronic
1185401160 22:50618099-50618121 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
949323250 3:2835190-2835212 CCACCTCGCCCGGCAGATAAAGG + Intronic
949982318 3:9509464-9509486 GCACAGTGCCTGGCACATAGTGG - Intronic
950349566 3:12334518-12334540 CCACCGTGCCTGGCTGACTTGGG + Intronic
951176379 3:19605774-19605796 CCACAGTGCCCGGCAGAAGCAGG - Intergenic
951593540 3:24292640-24292662 GCACTGTGCCTGGCAAATAGTGG + Intronic
951882089 3:27489380-27489402 CCAGAGTGCCTGGCACATAGTGG + Intergenic
952377278 3:32778303-32778325 CCACCGTGCCTGGCCTTTGCTGG + Intergenic
953131441 3:40143161-40143183 ACACAGTGCCTGGCACATAGTGG + Intronic
953156521 3:40380125-40380147 GCACAGTGCCTGGCACATAGAGG + Intergenic
953366136 3:42346851-42346873 CCACCGTGCCTGGCCGACAAGGG + Intergenic
954286025 3:49619905-49619927 CCACAGTGCCTGGCACAAACTGG - Intronic
954472135 3:50707206-50707228 CCACCATGCCTGGCCAAGACTGG - Intronic
954960746 3:54562711-54562733 CCACGCTGCTTGGCAGATACTGG - Intronic
955079102 3:55641260-55641282 CCACCATGCCTGGCCTATATTGG - Intronic
955145770 3:56317658-56317680 CCCCAGTGCCTGGCACATAGGGG - Intronic
955152668 3:56383527-56383549 TCACAGTGCCTGGCACATAGTGG + Intronic
955672015 3:61412038-61412060 CCACCGTGCCTGGCCCAGAATGG - Intergenic
955903777 3:63785357-63785379 CCACCGTGCCTGGCCTCCACTGG + Intergenic
956657233 3:71564352-71564374 ACAGGGTGCCTGGCAAATACAGG - Intronic
957867955 3:86049546-86049568 CCACCGTGCCTGGCCAAGACTGG + Intronic
957919434 3:86729992-86730014 CCACCGTGCCCGGCTGAAAGTGG - Intergenic
958999803 3:100950210-100950232 GCACGGTGCCTGGCAGAGAAAGG + Intronic
959150330 3:102599985-102600007 CCACCGCACTTGGCAGTTACTGG + Intergenic
959983765 3:112549519-112549541 CCACCGCGCCTGGCTGAAACAGG - Intronic
960103918 3:113773223-113773245 CCACCGTGCCTGGCCAATATTGG + Intronic
960110666 3:113841577-113841599 CCACCGTGCCTGGCTGAAGTAGG + Intronic
960671459 3:120158631-120158653 TCACAGTGCCTGGCACATAGTGG + Intergenic
961004461 3:123395585-123395607 CCACCATGCCTGGCTGACATGGG - Intronic
961013883 3:123452635-123452657 CCACCGCGCCCGGCCAATACTGG - Intergenic
961139219 3:124541597-124541619 CCACTGTGCCCGGCCGATCCAGG - Intronic
962446893 3:135473903-135473925 CCACCGTGCAAGTCAAATACAGG + Intergenic
962551875 3:136501892-136501914 CCACTGTGCCCGGCCTATACTGG - Intronic
962986856 3:140544131-140544153 GCACTGTGCCTGGCACATAGCGG - Intronic
963090203 3:141476944-141476966 CCACCGTGCCTGGCCAATCTTGG + Intergenic
963210164 3:142680350-142680372 CCACCATGCCTGGCCAAAACTGG + Intronic
963715317 3:148796210-148796232 CCACTGTGCCTGGCCCTTACTGG - Intronic
964224235 3:154378951-154378973 CCACCGCGCCCGGCCGATAAAGG - Intronic
964349394 3:155787902-155787924 CCACCGCGCCCGGCCTATACTGG - Intronic
964546370 3:157838806-157838828 CCACTGTGCCTGGCTGTCACTGG - Intergenic
964589541 3:158344929-158344951 CCACCGTGCCTGGCCTAGATTGG - Intronic
965600002 3:170445217-170445239 CCACCGTGCCTGGCCTGAACTGG - Intronic
966373815 3:179275439-179275461 CCACCGTGCCCGGCCAATACTGG - Intergenic
966416421 3:179694260-179694282 CCACTGTGCCCGGCCGATTCTGG + Intronic
966542912 3:181111689-181111711 CCACTGTGCCTGGCTGATGGTGG - Intergenic
966723943 3:183091753-183091775 CCACCGTGCCTAGCCAATCCAGG - Intronic
966984324 3:185165636-185165658 CCACCACGCCTGGAAGAAACAGG + Intergenic
967349005 3:188491045-188491067 CCACCGCGCCTGGCCGGCACTGG + Intronic
967557418 3:190876058-190876080 CCACTGTGCTTGGCTGACACTGG + Intronic
967798857 3:193632192-193632214 CCACCGTGCCTGGCTGTGATAGG - Intronic
967907703 3:194515375-194515397 CCACCGCGCCTGGCCGGAACTGG + Intergenic
968118241 3:196106104-196106126 CCACCGGGCCTGGCCGAGATGGG + Intergenic
968149441 3:196325485-196325507 CCACCGTGCCCGGCCCATATTGG + Intronic
968214395 3:196876008-196876030 CCACCATGCCTGGCCAATATTGG + Intronic
968245572 3:197143541-197143563 CCACCGTGCCTGGCAACAGCTGG + Intronic
968452903 4:683478-683500 CCACCCTGGCTGGCAGAGGCTGG + Intronic
969959749 4:10932658-10932680 CCACCGTGCCTGGCCAACAATGG - Intergenic
970197011 4:13561099-13561121 CCACCGTGCCTGGCCGCCACAGG + Intergenic
970239217 4:13990676-13990698 GCAGAGTGCCTGACAGATACTGG + Intergenic
970372603 4:15423344-15423366 GCACAGTGCCTGGCACACACAGG + Intronic
970603651 4:17659771-17659793 CCACCGTGCCTGGCTGCAACAGG + Intronic
971105087 4:23515888-23515910 CCACCGTGCCTGGCGTAAAATGG - Intergenic
971405481 4:26318709-26318731 CCACCGCGCCTGGCAGCAATTGG - Intronic
972089185 4:35258324-35258346 CCACCGGGCCAGGGAGAGACAGG - Intergenic
972414500 4:38825082-38825104 CCAACGTGCCTGGCCGAAACTGG + Exonic
972569926 4:40301282-40301304 CCACCGCGCCTGGCCTAGACTGG + Intergenic
972624106 4:40779314-40779336 CCACAGTGCCTGGCAGAGACAGG - Intronic
972630635 4:40838754-40838776 CCACCATGCCTGGCAAAAGCAGG + Intronic
972770728 4:42194543-42194565 CCACCGTGCCCGGCCTAGACTGG + Intergenic
973019729 4:45187646-45187668 CCACTGTGCCTGGCTGCTCCTGG - Intergenic
973091475 4:46142355-46142377 CCACCGTGTCTTGCAGATGATGG + Intergenic
973753052 4:54043132-54043154 CCACCGCGCCTGGCCGAGACAGG - Intronic
973992667 4:56426113-56426135 CCACCGTGCCTGGCAGATACGGG - Intronic
974767200 4:66362165-66362187 CCACCGTGCCTGGCTGTAAATGG + Intergenic
975127321 4:70797555-70797577 CCACCGTGCCTGGCCTAGAGTGG - Intronic
976038394 4:80852906-80852928 GCACAGTGCCTGGTACATACTGG - Intronic
976264760 4:83180069-83180091 CCACCGCGCCTGGCTGGTCCTGG + Intergenic
976513467 4:85936925-85936947 CCACAGTGCCTGGCACACAATGG + Intronic
976707258 4:88032374-88032396 CCATCGTGCCTGGCCGATACTGG - Intronic
977032840 4:91908620-91908642 CCACGGCGCCTGGTAGATTCTGG - Intergenic
977579889 4:98713679-98713701 CCACCATGCCTGGCCGATTAGGG + Intergenic
977813565 4:101386885-101386907 CCACCATGCCTGGCAGTTGCTGG + Intergenic
977866561 4:102035359-102035381 CCACCGTGCCTGGCCAACATGGG - Intronic
978353353 4:107844033-107844055 CCACCGTGCCTGGCAAAAAGAGG - Intronic
978764355 4:112389329-112389351 CCACCGTGCCTGGCCTGTGCTGG + Intronic
978845317 4:113266588-113266610 CCACCATGCCTGGCAGAGATAGG - Intronic
979935605 4:126690699-126690721 CCACCTTGCCTGGCCGGGACTGG - Intergenic
980736262 4:136893273-136893295 ACACAGTGCCTGGCAAAAACTGG + Intergenic
980884346 4:138745992-138746014 CCACTTTGCCTGGCCGACACAGG - Intergenic
980942943 4:139292122-139292144 CCACCGCGCCTGGCAGATTTTGG + Intronic
980955740 4:139427597-139427619 CCACCGCACCTGGCCGAGACTGG + Intergenic
981177035 4:141693440-141693462 CCATAGTGCCTGACACATACGGG + Intronic
981697757 4:147575708-147575730 CCACCATGTCTGGCTGACACTGG + Intergenic
981999032 4:151005157-151005179 CCACCGTGCCCGGCCATTACAGG - Intronic
982643606 4:157994161-157994183 CCACCATGCCTGGCAGTTTAAGG - Intergenic
982859877 4:160435088-160435110 CCATCCTGCCTGGCTGACACTGG + Intergenic
982920506 4:161267816-161267838 CCACCGTGCCCGGCCGAAAATGG + Intergenic
983239047 4:165210227-165210249 GCACAGTGCCAGGCAGAGACAGG - Intronic
984030645 4:174599784-174599806 CCACCGTGCCTGGCCTGGACTGG - Intergenic
984331548 4:178327149-178327171 ATACAGTGCCTGGCACATACTGG - Intergenic
985657649 5:1140396-1140418 CCACCGGGTCTGGAAGACACTGG + Intergenic
986691458 5:10316997-10317019 CCACCGCGCCTGGCAGCTTTTGG + Intergenic
987576571 5:19735680-19735702 CCACTGTGCCCAGCCGATACTGG + Intronic
987804367 5:22744140-22744162 CCACCGCGCCTGGCCTATACTGG - Intronic
987904199 5:24054441-24054463 CCACCGTGCCCAGCAGTTTCAGG - Intronic
987982072 5:25098375-25098397 CCACCGTGCCCGGCAGAACCAGG + Intergenic
988327206 5:29785949-29785971 CCACTGTGCCTGGCCTACACTGG - Intergenic
988983248 5:36592773-36592795 CCACCGTGCCCGGCCTCTACTGG - Intergenic
989385366 5:40850125-40850147 CCACCGCACCTGGCCGATACTGG - Intronic
989410945 5:41119848-41119870 CCACCATGCCTGGCCGATTTTGG + Intergenic
989428816 5:41327956-41327978 CCACTGTGCTTGGCAGATGCTGG + Intronic
989622704 5:43400470-43400492 CCACTGCGCCTGGCAGATTTTGG + Intronic
990248916 5:53892890-53892912 CTACTGTGCCTGGCCTATACTGG + Intronic
990319131 5:54612548-54612570 CCACCGTGCCTGGCTGAGGGTGG + Intergenic
990412997 5:55559804-55559826 CCACCGCGCCCGGCCGAGACAGG - Intergenic
991632943 5:68674983-68675005 GCACAGTGCCTGGCACATAGTGG + Intergenic
991714269 5:69436949-69436971 CCACTGTGCCTGGCCGAGATGGG - Intronic
992055763 5:72987623-72987645 CCACCGTGCCTGGCTGATTAGGG + Intronic
992085238 5:73272240-73272262 CCACCGTGCCTGGCCACCACAGG + Intergenic
992333710 5:75743416-75743438 CCACTGTGCCTGGCCAACACTGG + Intergenic
992403311 5:76431535-76431557 CCACCGTGCCCGGCCAAGACTGG - Intronic
993584538 5:89707962-89707984 CCAACTTGCCTGGCAGATAGTGG + Intergenic
995380186 5:111523106-111523128 CCACCATGCCTGGCTGAGACAGG - Intergenic
996547059 5:124691115-124691137 CCACCATACCTGGCTGAGACGGG - Intronic
996554554 5:124764309-124764331 CCACCGCGCCTGGCCAATATGGG + Intergenic
996624249 5:125550957-125550979 CCACCGTGCCCGGCCCATCCCGG - Intergenic
996702108 5:126460672-126460694 GCTCCGTGGCTGGCAGACACAGG - Intronic
996842361 5:127861293-127861315 CCACCGTGCCTGGCCCATCTTGG + Intergenic
997261071 5:132465871-132465893 CCACCGTGCCGGGCTGACAGTGG + Intronic
997381907 5:133444389-133444411 CCACCCTGCCTGGCAGTGCCCGG + Intronic
997531381 5:134583571-134583593 CCACCATGCCTGGCTGATTTTGG + Intergenic
997539642 5:134651060-134651082 CCACTGTGCCTGGCCTCTACAGG + Intronic
997608800 5:135195893-135195915 CCACCGTGCCTGGCTAATTTTGG + Intronic
998443670 5:142182180-142182202 CCACTGTGCCTGGCCGGGACTGG - Intergenic
998450121 5:142227783-142227805 CCACCGTGCCCGGCCGATATTGG - Intergenic
998478652 5:142442895-142442917 ACACAGTGCCTGGCACATAGAGG + Intergenic
999797470 5:155001928-155001950 CCACCGTGCCTGGCCGAAATAGG - Intergenic
999983156 5:156977127-156977149 CCACCGTGCCTGGCCAACAATGG - Intergenic
1001082067 5:168674777-168674799 CCACCGTGCCTGGCTGGTTATGG + Intronic
1002003120 5:176209676-176209698 CCACCATGCCTGGCATAGACTGG + Intergenic
1002208209 5:177578958-177578980 CCACCGTGCCCGGCCAATAGAGG - Intergenic
1002223344 5:177701274-177701296 CCACCATGCCTGGCATAGACTGG - Intergenic
1002282342 5:178138911-178138933 CCACTGTGCCTGGCAATTTCTGG - Intronic
1002514777 5:179749546-179749568 CCACTGTGCCTGGCCGAAAAAGG + Intronic
1003045395 6:2728900-2728922 CCACGGTGGATGGCAGATCCTGG + Intronic
1003858367 6:10298778-10298800 CCACCATGCCTGGCTGGTTCTGG + Intergenic
1004363668 6:14993729-14993751 CCACCGTGCCTGGCCGAAGAGGG + Intergenic
1004382424 6:15144035-15144057 CCACCGCGCCTGGCTCATACTGG - Intergenic
1004485839 6:16065645-16065667 CCACCGCGCCTGGCTGAAATTGG + Intergenic
1004621996 6:17338997-17339019 CCACCGTGCCTGGCCCATATTGG - Intergenic
1004854433 6:19734931-19734953 CAACCCTGTCTGGTAGATACTGG + Intergenic
1004993379 6:21163797-21163819 CCACCATGCCTGGCTGATTTTGG - Intronic
1005062823 6:21792945-21792967 CCACCGTGCCTGGCCTCTAGAGG + Intergenic
1005346744 6:24897910-24897932 CCACCATGCCTGGCTGAGGCAGG + Intronic
1005474782 6:26197109-26197131 CCACCGTGCCGGGCCGGTAACGG + Exonic
1006080928 6:31566023-31566045 CCACCGTGCCTGGCTAATTTTGG - Intergenic
1006193914 6:32225797-32225819 CCACCGCACCTGGCCGATACTGG + Intergenic
1006367881 6:33626220-33626242 CCGCCGTGCCTGGCCGTTGCTGG + Intronic
1006636417 6:35464522-35464544 CCACCGTGCCCGGCCGAGACAGG + Intronic
1006822633 6:36910438-36910460 CCACCATGCCTGGCCAATAAAGG - Intronic
1007074622 6:39058547-39058569 CCACGGTGCCTGGGTGAAACTGG - Intronic
1007313986 6:40969604-40969626 CCACCTTTTCAGGCAGATACAGG + Intergenic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007451728 6:41945224-41945246 CCACCGTGCCTGGCCCAGATGGG - Intronic
1007539543 6:42628432-42628454 CCACTGTGCCTGGCCAGTACTGG - Intronic
1007539644 6:42629302-42629324 CCACTGTGCCCGGCTGATAGTGG + Intronic
1007705491 6:43788222-43788244 CCACCGCGCCCGGCAGGTAGGGG + Intergenic
1007757192 6:44107496-44107518 CCACCGTGCCTGGCTGAGATGGG - Intergenic
1008264762 6:49411253-49411275 CCACCGCGCCCGGCCGACACAGG + Intergenic
1008925368 6:56886486-56886508 CCACCATGCCTGGCTGTTTCAGG - Intronic
1009386931 6:63096308-63096330 CCACCATGCCTGGCCCATATGGG - Intergenic
1009416793 6:63424633-63424655 CCACTGTGCCTGGCTTTTACTGG - Intergenic
1009705108 6:67239419-67239441 CGAGGGTGCCTGGCACATACTGG - Intergenic
1009909860 6:69912798-69912820 CCACCGTGCCTGGCCTCTACTGG - Intronic
1009918413 6:70025315-70025337 CCACCGTGCCCGGCAGACTTGGG + Intronic
1009926673 6:70128895-70128917 CCACAGAGCCTGGAAGATAGTGG + Intronic
1009953095 6:70419131-70419153 CCACCATGCCTGGCCAAAACAGG - Intronic
1010218563 6:73427586-73427608 CCACCATGCCTGGCCAATACTGG + Intronic
1010309366 6:74365823-74365845 CCACCGCGCCTGGCCTATCCTGG - Intergenic
1011102208 6:83735321-83735343 CCACCGCGCCTGGCCTAAACTGG + Intergenic
1011201971 6:84846688-84846710 CCACCGTGCCTGGCCAAGAAAGG - Intergenic
1011257827 6:85442041-85442063 CCACCGCACCTGGCCGATACTGG - Intergenic
1011287004 6:85735570-85735592 CCACCATGCCTAGCCAATACTGG + Intergenic
1011667300 6:89647072-89647094 CCACCATGCCTAGATGATACAGG + Intronic
1011690271 6:89860555-89860577 CCACTGTGCCTGGCCTATATTGG - Intronic
1012020177 6:93908209-93908231 CCACTGTGCCTGGCTGAAATAGG - Intergenic
1012697991 6:102413646-102413668 CCACTGTGCCTGGCCAAGACAGG + Intergenic
1013283267 6:108658709-108658731 CCACCGTGCCTGGCCAACATTGG + Intronic
1013536442 6:111067080-111067102 CCACCATGCCTTGGAGGTACAGG - Intergenic
1014750994 6:125256059-125256081 CCACCGTGCCTGGCCCCTAATGG - Intronic
1014888108 6:126807031-126807053 ACACCATGTCTGGCACATACCGG + Intergenic
1015047521 6:128794179-128794201 CCACCATGCCTGGCTCATCCCGG - Intergenic
1015279583 6:131418913-131418935 CCACTGTGCCTGGCTGAGACTGG + Intergenic
1015344417 6:132139026-132139048 CCACCATGACTGGCCAATACGGG - Intergenic
1015570454 6:134616053-134616075 GCACAGTGCCTGGCACATAGTGG - Intergenic
1016832719 6:148449355-148449377 TCACCGTACCTGGCTGAGACTGG + Intronic
1016954069 6:149609515-149609537 CCACCATGCCTGGCCGAGACAGG - Intronic
1017026245 6:150183791-150183813 CCACCGTGCCCGGCCCAAACTGG + Intronic
1017419480 6:154258988-154259010 CCTATGTGCCTGGCAGATAGTGG + Intronic
1017476240 6:154796683-154796705 CCACCGTGCCTGGCCCCTAGAGG - Intronic
1017581776 6:155872705-155872727 CCACCGTGCCTGGCTAATTTTGG + Intergenic
1017703047 6:157094640-157094662 CCACCGCGCCTGGCCGATTTAGG + Intronic
1017849813 6:158295600-158295622 CCACCATGCCTGGCCAATGCTGG - Intronic
1018223172 6:161601867-161601889 CCACCGCGCCCGGCATATAGTGG + Intronic
1018554072 6:165032815-165032837 CCACCATGCCTGGCTGAGGCTGG - Intergenic
1018852247 6:167649144-167649166 CCACCGTGCCCGGCCTATCCCGG - Intergenic
1019644397 7:2121329-2121351 CCACGGTGCCTGGCAGGTGCTGG - Intronic
1019855366 7:3600833-3600855 CCACCGTGCCTGGCCAATGTAGG + Intronic
1019969324 7:4527504-4527526 CCACCGTGCCTGTCAAGTGCAGG - Intergenic
1020084267 7:5302236-5302258 CCACCATACCTGGCTGAGACTGG + Intronic
1020195341 7:6033854-6033876 CCGCCGTGCCTGGCCGACAATGG + Intronic
1020827284 7:13045302-13045324 GCACCGTGCCTGGCACATATTGG - Intergenic
1020918774 7:14234035-14234057 CCCCCTTGCCTGGCAAGTACAGG + Intronic
1021470412 7:20996166-20996188 CCACAGCGCCTGGCTGAGACTGG + Intergenic
1022057461 7:26753729-26753751 TCACAGTGCCTGGCACATAGTGG - Intronic
1024012733 7:45283890-45283912 CCACCGTGCCTGGCCTACAGTGG - Intergenic
1024333610 7:48180712-48180734 CCACCATGCGTGGCCGATGCTGG + Intronic
1025611256 7:63077322-63077344 ACAGCAGGCCTGGCAGATACTGG - Intergenic
1025774203 7:64544969-64544991 CCACCATGCCTGGCCAACACAGG - Intronic
1025950656 7:66142782-66142804 CCACCGTGCCTGGCTTCTCCTGG + Intronic
1025958043 7:66197679-66197701 CCACCGTGCCTGGCCCATTCTGG + Intergenic
1025987955 7:66472538-66472560 CCACCGTGCCTGGCCACTAATGG + Intergenic
1026039603 7:66856577-66856599 CCACCGTGCCTGGCCAAGACAGG + Intergenic
1026279074 7:68905564-68905586 CCACCGCGCCTGGCCAATATTGG + Intergenic
1026346479 7:69478780-69478802 CCACCCTGCCTGGCCAAAACAGG + Intergenic
1026830064 7:73605269-73605291 CCACCATGCCTGGCAGGTCTGGG - Intronic
1026831248 7:73611526-73611548 CCACCGTGCCCAGCAGATTTTGG - Intronic
1026856602 7:73759139-73759161 CCACCGTGCCTGGCTGTCCCTGG - Intergenic
1026989359 7:74574746-74574768 CCACCGTGCCCGGCCTATGCTGG + Intronic
1027003177 7:74668857-74668879 CCACCGTGCCTGGCTAAGAAGGG + Intronic
1027049969 7:75015777-75015799 CCACCGCGCCTGGCCGAGGCAGG - Intronic
1027059230 7:75072690-75072712 CCACTGTGCCTGGCTGAAAGAGG - Intronic
1027124788 7:75548749-75548771 CCACTGTGCCTGGCAAATTCTGG + Intronic
1027146097 7:75695860-75695882 CCACCGTGCCTGGCTGGTACTGG + Intronic
1027176715 7:75908628-75908650 CCACCGTGCCTGGCCCAGCCTGG + Intronic
1028153444 7:87402712-87402734 CCACCTTGCCCGGCTGATAGTGG - Intronic
1028449412 7:90963999-90964021 CCACTGTGCCTGGCCGACAAAGG + Intronic
1028955996 7:96691056-96691078 CCACTGCGCCTGGCCTATACTGG + Intronic
1029158649 7:98535271-98535293 CCACTGAGCCTGGCTGATTCAGG + Intergenic
1029331645 7:99861159-99861181 CCACCATGCCTGGCCTAAACAGG + Intronic
1029525326 7:101090335-101090357 CCACTGCGCCTGGCAGAGCCTGG - Exonic
1029541009 7:101181956-101181978 CCACCGTGCCCGGCCGATGCAGG + Intergenic
1029626188 7:101721717-101721739 CCACCGTGCCTGGCACAAACCGG - Intergenic
1029808620 7:103022987-103023009 CCACCGTGCCTGGCTAATGGTGG - Intronic
1030082414 7:105789281-105789303 GCACAGTGCCTGGCACATTCAGG - Intronic
1030217933 7:107065764-107065786 TCACAGTGCCTGGCAGATAAAGG - Intronic
1030813390 7:114004352-114004374 CCACCATGCCTGGCAGTTTTGGG - Intronic
1030829521 7:114203629-114203651 CCACCATGCCTGGCAGCACCTGG + Intronic
1031030332 7:116727428-116727450 CCTCAGTGCCTGGCACATTCTGG + Intronic
1031196653 7:118623677-118623699 CCACCGTGACTGGCCCATATAGG + Intergenic
1032164805 7:129537222-129537244 CCACTGTGCCCGGCAGAGAATGG - Intergenic
1032287775 7:130555537-130555559 CCACCGTGCCTGGCTGACACTGG - Intronic
1032364516 7:131286816-131286838 CCACCGTGCCTGGCCCATTGGGG - Intronic
1032568766 7:132976473-132976495 CCATAGTGCCTGGCACATAGAGG + Intronic
1032626145 7:133593032-133593054 CCACCGTGCCTGGCCTAAATTGG + Intronic
1032710516 7:134456726-134456748 TCACAGTGCCTGGCAAATATAGG - Intronic
1033183337 7:139202076-139202098 CCACTGTGCCTGGCTGGTAAAGG - Intergenic
1033329928 7:140409405-140409427 CCACCGTGCCTGGCAGTTTATGG - Intronic
1033454732 7:141492489-141492511 GCACAATGCCTGGCACATACTGG + Intergenic
1033786703 7:144740431-144740453 CCACCATGCCTGGCCTCTACTGG - Intronic
1033907471 7:146223042-146223064 CAACAGTGCCTGGCACATATAGG - Intronic
1033965746 7:146973313-146973335 CCACCGCGCCTGGCCCACACTGG + Intronic
1034105816 7:148488807-148488829 CCACCGTGCCCGGCTGCTTCAGG + Intergenic
1034152810 7:148929951-148929973 GCACGGTGCCTGGCTGAGACAGG - Intergenic
1034510908 7:151533866-151533888 CCACCGTGCCAGGCTGAGACAGG + Intergenic
1034631785 7:152536650-152536672 GCAACGTGCCTGGCACATAGTGG + Intergenic
1034904286 7:154930192-154930214 CCACCATGCCTGGCTGAAATTGG + Intronic
1035054120 7:156022601-156022623 CCACCGTGCCCGGCCGAGACTGG + Intergenic
1035183629 7:157108864-157108886 CCACCTTGACTGGCAGCAACTGG + Intergenic
1035220676 7:157404791-157404813 CCACCGTGCCTGGCCCAGATGGG + Intronic
1035259683 7:157653490-157653512 CCACCCTCCCTGGCACACACAGG - Intronic
1035605051 8:924871-924893 CCACCGCGCCTGGCCAATCCAGG + Intergenic
1036439578 8:8768615-8768637 CCACCATGCCTGGCCTATTCTGG + Intergenic
1036956247 8:13191217-13191239 CCACTGTGCCTGGCCAATAAGGG - Intronic
1037017650 8:13928570-13928592 CCACCATGTCTGGCTGATTCTGG - Intergenic
1037051655 8:14381485-14381507 TCACCGTGCCTGGCTGCTATGGG - Intronic
1037322508 8:17657230-17657252 CCACCGTGCCTGGCCTATGTGGG - Intronic
1037804895 8:22053695-22053717 CCCCCCTGCCTGAGAGATACAGG + Intronic
1038503639 8:28065445-28065467 CCACCGCGCCTGGCCGAAATTGG + Intronic
1038601348 8:28946238-28946260 CCACCGTGCCCGGCCCATAGGGG + Intronic
1038628932 8:29222057-29222079 CCACTGTGCCTGGCATATATAGG - Intronic
1039088696 8:33805292-33805314 CCACAGTGCCTGGCCAATGCAGG + Intergenic
1039405468 8:37308818-37308840 CCACCGTGCCCAGCCAATACCGG + Intergenic
1039792527 8:40887191-40887213 CCACCGTGCCTGGCCAAAACCGG - Intronic
1039814383 8:41080158-41080180 CCACCGTGCCTGGCCGCAAGAGG - Intergenic
1039878878 8:41610937-41610959 CCACCGTGCCTGGCCACCACTGG - Intronic
1039960136 8:42239924-42239946 CCACCGTGCCTGGCCGTAAAAGG + Intergenic
1040432292 8:47355241-47355263 CCACCATGCCTGGCCGATGAAGG + Intronic
1040844351 8:51821536-51821558 TAACAGTGCCTGGCAGATATAGG - Intronic
1040870216 8:52092851-52092873 CCACCATGCCTGGCCGAGATAGG + Intergenic
1040934411 8:52767612-52767634 CCCCCGTGCCTGGCCGATATTGG + Intergenic
1042140243 8:65670980-65671002 CCACTGTGCCTGGCAGAATATGG + Intronic
1042410388 8:68459516-68459538 CCACCGTGCCCGGCTGAAAAGGG + Intronic
1043458683 8:80437858-80437880 TCACAGGGCCTGGCACATACTGG - Intergenic
1043793861 8:84510521-84510543 CCACCGTGCCTGGCTGAAGCTGG - Intronic
1043872319 8:85447607-85447629 CCATCGTGCCTGGCCAATACTGG - Intronic
1044574816 8:93756786-93756808 CCACTGTGCCTGGCCTATACAGG - Intronic
1045003571 8:97898632-97898654 CCACAGTGCCTGGCACATGGTGG - Intronic
1045229460 8:100288771-100288793 CCACCGCGCCTGGCCTATATGGG - Intronic
1045610505 8:103835386-103835408 CCACCGTGCCTGGCCAAGACTGG + Intronic
1046131099 8:109969557-109969579 CCACCGTGCCCGGCCCATAATGG - Intronic
1046175761 8:110573021-110573043 CCACCATGCCTGGTAGAGATGGG - Intergenic
1046402921 8:113730621-113730643 CCACTGCGCCTGGCCCATACTGG + Intergenic
1046561033 8:115837635-115837657 CCACCGTGCCCGGCCTCTACAGG - Intergenic
1046937819 8:119902624-119902646 CCACCATGTCTGGCAGATTTAGG + Intronic
1047262790 8:123276673-123276695 CCACAGTGCCTGGCATATACTGG - Intergenic
1047390468 8:124446517-124446539 CCACAGTGCCTGGCATATTTTGG + Intergenic
1047766899 8:127997326-127997348 CCACCGAGCCTGGCCGCTTCCGG + Intergenic
1048407653 8:134139469-134139491 CCATCGTGGCAGGCAGATATAGG + Intergenic
1048797237 8:138162267-138162289 CCCCCGTGCCTGGCAACCACTGG - Intronic
1048884821 8:138901652-138901674 CCACCATGCCTGGCCTTTACTGG + Intronic
1048942426 8:139413255-139413277 CCACCGTGCCTGGCTGAAAGTGG - Intergenic
1049243480 8:141550224-141550246 TCACCGTGCTTGGCAGATACAGG - Intergenic
1049327730 8:142032303-142032325 CCCCAGTGGCTGGCAGATAAGGG + Intergenic
1049334392 8:142075155-142075177 GCACCGTGGCTGACACATACAGG + Intergenic
1049695145 8:143980032-143980054 CCACCGCGCCCGGCTGAGACGGG - Intronic
1050152429 9:2630079-2630101 CCACCGTGCCTGGCCCAAACTGG + Intronic
1050358758 9:4807804-4807826 CCCCCGCGCCTGGCAGCTATGGG + Intronic
1050536351 9:6634115-6634137 CCACCGCGCCCGGCAGAGGCGGG + Intronic
1051330088 9:16015485-16015507 CCACCTTGGCTGAAAGATACTGG - Intronic
1052310061 9:27057568-27057590 CCACCGTGCCTGGCCAAAAGAGG - Intronic
1052787349 9:32841653-32841675 ACACAGTGCCTGGCACATACAGG + Intergenic
1052839451 9:33279574-33279596 CCACCGCGCCTGGCCGCTACAGG - Intronic
1052951573 9:34217521-34217543 CCACCGTGCCTGGCTGGTGGCGG + Intronic
1053061352 9:35034696-35034718 CCACCGTGCCTGGCAACACCTGG - Intergenic
1053438487 9:38094319-38094341 CCACCGTGCCTGGCTGCTTGGGG + Intergenic
1054916201 9:70497402-70497424 CCACCGTGCCTGGCCAAGAAAGG + Intergenic
1055959611 9:81808033-81808055 CCACCGCGCCTGGCCTATAGTGG + Intergenic
1056096979 9:83265111-83265133 CCACCGCACCTGGCCGACACGGG - Intronic
1056640288 9:88364478-88364500 CCATCGTGCCTGGCAGCTGTAGG - Intergenic
1056708992 9:88975573-88975595 CCACTGTGCCCGGCAGTTACTGG - Intergenic
1056983188 9:91336342-91336364 CCACCATGCCTGGCCAATCCAGG - Intronic
1057063569 9:92026962-92026984 CCACCGTGCCTGGCCTAGAGAGG - Intergenic
1057345067 9:94242960-94242982 CCACCGTGCCTGGTTGGAACGGG - Intergenic
1057613773 9:96569873-96569895 CCACCGCGCCTGGCCGAAACAGG + Intronic
1057862043 9:98648418-98648440 CCACCGCACCTGGCCCATACAGG + Intronic
1057974129 9:99586028-99586050 CAACCATGCTTGGCACATACTGG + Intergenic
1058145422 9:101405786-101405808 CCACCGTGCCTGGCCTAAAATGG - Intronic
1060456056 9:123799195-123799217 TCACAGTGCCTGGCAAATAGTGG - Intronic
1060483059 9:124029315-124029337 CCCCGGTGCATGGCAGAGACTGG - Intronic
1060547976 9:124471749-124471771 GCACAGTGCCTGGCACACACTGG - Intronic
1060639932 9:125229937-125229959 GCACAGTGTCTGGCAGATAGTGG + Intronic
1060664521 9:125424775-125424797 CCACCATGCCCGGCAAAGACAGG + Intergenic
1061206810 9:129168975-129168997 GCACAGTGCCTGGCATATATAGG + Intergenic
1061240937 9:129371935-129371957 CCACCATGCCCGGCCGATAGAGG - Intergenic
1061249197 9:129416590-129416612 CCACCGTGCCAGGCAGTGACAGG - Intergenic
1061501168 9:131003188-131003210 CCACCGTGCCCGGCCGAGATGGG - Intergenic
1061688173 9:132301372-132301394 CCACTGTGCCTGGCCTATTCTGG + Intronic
1061910934 9:133723473-133723495 CCACCATGCCTGGCAGAAGAAGG - Intronic
1062083935 9:134638909-134638931 CCACAGTGCCTAGCAGAGAGTGG - Intergenic
1062459404 9:136656621-136656643 CCACTGTGCCTTGCGGAGACTGG + Intergenic
1062714288 9:137998321-137998343 CCACCGTGCCCGGCCTACACTGG - Intronic
1185494007 X:540558-540580 CCACTGTGCCTGGCCCATGCAGG + Intergenic
1185714971 X:2334315-2334337 CCACCATGCCTGGCTAATATTGG + Intronic
1185740524 X:2528280-2528302 CCACCATGCCTGGCCAAGACTGG + Intergenic
1185790325 X:2924319-2924341 CCACCGTGCCCGGCCCACACAGG + Intronic
1186880922 X:13865442-13865464 CCACCGTGCCTGGCTGAGAATGG - Intronic
1186884953 X:13903787-13903809 CCACCCTGGCTGCCAGACACAGG - Intronic
1187166692 X:16810965-16810987 CTACCGTGCCTGGCCAATAGTGG + Intronic
1187544444 X:20234001-20234023 CCAATGTGCCTGGCACATAATGG - Intronic
1187867852 X:23740392-23740414 CCACCGCGCCTGGCATGTAATGG + Intronic
1187871891 X:23771456-23771478 CCACCGTACCCGGCTGAGACAGG - Intergenic
1188076018 X:25776045-25776067 CCACCGTGCCTGGCTCATTAAGG - Intergenic
1188206281 X:27363228-27363250 CCACCGTGCCCGGCCAAGACTGG + Intergenic
1189066173 X:37811599-37811621 CCACTGTGCTTGGCAGAGAGCGG + Exonic
1189171859 X:38916876-38916898 ACACCGTGACTGGCAGGTAAGGG + Intergenic
1189456813 X:41198897-41198919 CCACCGTGCCCGGCCTATAATGG - Intronic
1189476331 X:41359041-41359063 CCACTGTGCCTGGCCTGTACAGG + Intronic
1189481931 X:41398657-41398679 CCACTGTGCCTGGCTGAAAATGG + Intergenic
1189827414 X:44933728-44933750 CCACCATGCCTGGCTAATTCTGG + Intronic
1189852716 X:45193064-45193086 CCACTGTGCCTGGCAGGCATTGG + Intronic
1189903768 X:45736165-45736187 CCACCATGCCTGGCCGAGTCAGG - Intergenic
1189990833 X:46592648-46592670 CCACTGTACCTGGCTGATAGAGG + Intronic
1190029614 X:46959426-46959448 ACACGGTGCCTGGTACATACTGG - Intronic
1190067295 X:47250172-47250194 CCATCGTGCCAGGCAGACAGTGG + Intergenic
1190087063 X:47404450-47404472 CCACCGCACCTGGCAGACAGAGG + Intronic
1190549266 X:51562486-51562508 CCACCGTGCCTGGCCTAAAATGG - Intergenic
1191634985 X:63366463-63366485 CCACCGTGCCTGGCACTTTGTGG - Intergenic
1191841828 X:65518752-65518774 GCACAGTGCCTGGCACATAGTGG + Intronic
1192235163 X:69290935-69290957 CCACCTTGCCTGGAAAATTCTGG - Intergenic
1192259736 X:69498076-69498098 CCACCATGCCTGGCCCACACTGG - Intergenic
1192372107 X:70522828-70522850 CCACCGCGCCTGGCCGACAGAGG + Intergenic
1193082547 X:77420416-77420438 CCACCGTGCCCAGCAGATCATGG + Intergenic
1193978112 X:88148903-88148925 CCACAGTGCCTGTCAGAGCCTGG - Intergenic
1193990850 X:88305249-88305271 CCACCGCGCCTGGCCGAGGCGGG - Intergenic
1194018716 X:88659663-88659685 CCACCGTGCCTGGCCGTTGCTGG - Intergenic
1194232665 X:91343343-91343365 CCACCGCGCCTGGCACATGTTGG - Intergenic
1194659486 X:96614130-96614152 CCACCGTGCCTGGCCAGTAGTGG - Intergenic
1194760270 X:97788221-97788243 CCACCATGCCTGGCAAATTTTGG - Intergenic
1195081818 X:101378369-101378391 CCACCGTGCCTGGCCAGTAAAGG + Intronic
1195264117 X:103163800-103163822 CCACCGCGCCTGGCCGAATCTGG - Intergenic
1196076590 X:111584856-111584878 CCACCGTGCCGGGCAAATGAAGG - Intergenic
1196150430 X:112367651-112367673 CCCCAGTGCCTGGCATATAGTGG - Intergenic
1196781944 X:119391583-119391605 CCACCGTGCCTGGCCAAGACTGG - Intergenic
1198227654 X:134660391-134660413 CCACCATGCCTGGCCGAAAGAGG + Intronic
1198253717 X:134906939-134906961 CCACCGTGCCAGGCCGAGGCAGG - Intronic
1198456148 X:136819839-136819861 CCACCGTGCCTGGCCTATCTTGG + Intergenic
1198473885 X:136976765-136976787 CCACCGTGCCTGGCCAACGCAGG + Intergenic
1198744339 X:139874345-139874367 CCACCGCGCCTGGCACAATCAGG + Intronic
1199828384 X:151523536-151523558 CCACCCTGCCTGGCAAACAAGGG - Intergenic
1200095354 X:153656992-153657014 CCACCAAGCTAGGCAGATACAGG - Intergenic
1200797512 Y:7354857-7354879 CCACTGTGCCTGGCAGAAAAGGG - Intergenic
1201450786 Y:14111651-14111673 CCACCATGCCTGGCAAATTTTGG + Intergenic