ID: 973993471

View in Genome Browser
Species Human (GRCh38)
Location 4:56435005-56435027
Sequence GGCTCCTCCCCGACTGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 224}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973993471_973993480 19 Left 973993471 4:56435005-56435027 CCGCCTGCAGTCGGGGAGGAGCC 0: 1
1: 0
2: 1
3: 17
4: 224
Right 973993480 4:56435047-56435069 CAAACCGGCGGTTTACAAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 24
973993471_973993478 7 Left 973993471 4:56435005-56435027 CCGCCTGCAGTCGGGGAGGAGCC 0: 1
1: 0
2: 1
3: 17
4: 224
Right 973993478 4:56435035-56435057 AGCTAGACCAAGCAAACCGGCGG 0: 1
1: 0
2: 1
3: 3
4: 39
973993471_973993482 30 Left 973993471 4:56435005-56435027 CCGCCTGCAGTCGGGGAGGAGCC 0: 1
1: 0
2: 1
3: 17
4: 224
Right 973993482 4:56435058-56435080 TTTACAAGCTGGCCAGCCTCTGG 0: 1
1: 0
2: 3
3: 43
4: 522
973993471_973993476 4 Left 973993471 4:56435005-56435027 CCGCCTGCAGTCGGGGAGGAGCC 0: 1
1: 0
2: 1
3: 17
4: 224
Right 973993476 4:56435032-56435054 CCCAGCTAGACCAAGCAAACCGG 0: 1
1: 0
2: 0
3: 7
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973993471 Original CRISPR GGCTCCTCCCCGACTGCAGG CGG (reversed) Intronic
900104099 1:974859-974881 GTCTCCTCCCTGACTCCTGGCGG - Exonic
900642910 1:3695823-3695845 GGATCGTCCCAGCCTGCAGGCGG - Intronic
900806567 1:4771495-4771517 GGCCCCTCCCCTGCTGCATGGGG - Intronic
901203018 1:7477247-7477269 CGCCCCTCCCCAGCTGCAGGAGG - Intronic
901928061 1:12579409-12579431 GGCTCCCTCTCGCCTGCAGGTGG - Exonic
902582066 1:17414022-17414044 GCCTCCTCCCCCACTGCTGGAGG - Intronic
902953856 1:19910843-19910865 AGCAACTCCCCGACTGAAGGTGG - Exonic
903183201 1:21615307-21615329 GGCCCCTTCCTGACTCCAGGTGG - Intronic
903668538 1:25022323-25022345 TGCTCCTCGCCCACAGCAGGGGG - Intergenic
903808701 1:26022643-26022665 TTCTCCTCCACGACTGCATGTGG - Exonic
904466048 1:30708073-30708095 GTATCCTCCCCAACTGCAGCTGG - Intergenic
906324461 1:44836145-44836167 GGCTCCTCCCCAGCATCAGGAGG + Intronic
911239364 1:95448804-95448826 GGCTCCTCCCTGGCTCAAGGTGG + Intergenic
913084387 1:115423392-115423414 GGCGCCACCCCAACAGCAGGTGG + Intergenic
915512682 1:156394983-156395005 GGCCACTCCCCTACTGCAGCTGG - Intergenic
916712878 1:167427503-167427525 AGCTCCTCCTGGAGTGCAGGAGG - Intergenic
916966268 1:169945480-169945502 TGCGCCTCCCCAACTGCAGCTGG + Intronic
922795854 1:228339107-228339129 GGCTCCAACCCACCTGCAGGAGG - Intronic
1064970296 10:21059131-21059153 GGCTTCACCCCGACTGCTGGGGG - Intronic
1065959204 10:30720463-30720485 GGGTCCTCCCCGACAGCAAAGGG + Intergenic
1073099111 10:100997854-100997876 TGCTCCGCCCCGGCTCCAGGGGG - Intronic
1073206912 10:101774458-101774480 CACTCCTCCCCAGCTGCAGGTGG - Intronic
1073292839 10:102421768-102421790 GGTGCCTCCCCGCCCGCAGGTGG + Exonic
1075119219 10:119651888-119651910 GGCGCCACCTCGACGGCAGGCGG + Intronic
1075522401 10:123150829-123150851 GGCGCCGCCCAGACTGCACGTGG + Intergenic
1075618830 10:123910829-123910851 GGATCCTCCCCGAGAGCTGGTGG - Intronic
1075650905 10:124128031-124128053 GGCCACTCCCCGCCAGCAGGAGG - Intergenic
1076193631 10:128499735-128499757 GGCCCCTCCCCACCTGAAGGAGG - Intergenic
1076698402 10:132257824-132257846 GGCTCCTCTACACCTGCAGGTGG + Intronic
1077515031 11:2996242-2996264 GGCTCCACCTGGACTGCAGTAGG - Intergenic
1077528588 11:3083923-3083945 GCCTCCTGCCCTACTGCAGCAGG - Intergenic
1078130831 11:8612827-8612849 GGCTCCTTCCCAACTACAGCAGG + Exonic
1081866906 11:46365184-46365206 AGCTCCTGCCTGCCTGCAGGAGG + Intronic
1083200664 11:61119232-61119254 AGCTCCTCCCAGGCTGCAGCTGG + Exonic
1083758438 11:64803294-64803316 GCCTCCTCCCGGACTGGCGGTGG - Intergenic
1084267152 11:68010908-68010930 AGCCCCGCCCCGCCTGCAGGAGG + Intronic
1085596930 11:77819872-77819894 TGCTCCTCCCCCACGGGAGGGGG - Intronic
1086265553 11:84993604-84993626 CCCTCCTCCCCGACAGTAGGAGG - Intronic
1087829866 11:102807985-102808007 GGCTCCTCCACGGCGGAAGGTGG + Intergenic
1089350521 11:117819341-117819363 GGCTCCTTCCTGAGTGCAGAAGG + Intronic
1090128438 11:124115032-124115054 TGCCCCTCCCCTACAGCAGGGGG - Intergenic
1091582768 12:1799107-1799129 GGGCCCTCCATGACTGCAGGAGG - Intronic
1094266607 12:28566856-28566878 GCCTTCTCCCCATCTGCAGGAGG + Intronic
1094466121 12:30755043-30755065 TGCTCCTTCCCGGCTGCAGCTGG + Intergenic
1096148025 12:49292894-49292916 GGCTCCTCCCCTAAAGCAGAAGG - Intergenic
1096155863 12:49341301-49341323 GGCTGTTCTCCGACTGCAGCTGG + Intergenic
1097218252 12:57430791-57430813 GGCTCGGCCCCGACGGCCGGCGG + Exonic
1097500135 12:60391929-60391951 AGCACCTCCCTGACTGCAGCTGG - Intergenic
1103980323 12:124732884-124732906 CGCTCCTCCCCGGCTGAGGGGGG - Intergenic
1104107250 12:125674745-125674767 GGCACCCCTCCCACTGCAGGAGG + Intergenic
1104713780 12:131003838-131003860 GGCTCCTCCCCAAGCGCAGCAGG - Intronic
1104742381 12:131188240-131188262 TGCACCTCCCCGGCTGCAGCTGG - Intergenic
1104925152 12:132310175-132310197 AGCTCCTCCCCTCCTGCTGGAGG - Intronic
1104973212 12:132540760-132540782 GGCCCCTCCCCGATGGCAGGAGG + Intronic
1105954576 13:25268691-25268713 TGCACCTCCCCCACTGCAGCTGG - Intronic
1107862984 13:44678473-44678495 GGCTCCTGCCTGGCTGCAGAGGG - Intergenic
1108002235 13:45915087-45915109 AGCACCTCCCCCACTGCAGCCGG - Intergenic
1110201012 13:72851102-72851124 CGCGCCTCCCCCACTGCAGCTGG - Intronic
1114344403 14:21780582-21780604 CGCACCTCCCCCACTGCAGCGGG - Intergenic
1114650181 14:24279782-24279804 GGCTGCTGCCCAGCTGCAGGGGG + Intergenic
1115217288 14:31026119-31026141 GGCCCCTCCCCGGCAGCAGCAGG - Exonic
1115610669 14:35046262-35046284 TGCGCCTCCCAGACTGCAGTTGG + Intronic
1121505594 14:94474351-94474373 GCCAACTCCCCGACTTCAGGTGG - Intronic
1122251486 14:100443067-100443089 GAGTCCTGCCCGGCTGCAGGTGG + Intronic
1122975570 14:105169305-105169327 GCCTCCACGCCGGCTGCAGGGGG + Intergenic
1125724130 15:41859629-41859651 GGCTTCTGCCCTCCTGCAGGAGG - Intronic
1125883802 15:43213847-43213869 GCGTTCTCCCCGACTTCAGGTGG - Intronic
1126761179 15:51971543-51971565 GGCACCTCCGGGAGTGCAGGGGG + Intronic
1128648431 15:69393628-69393650 CGCTCCTGCCCAACTGCAGCCGG - Intronic
1128965120 15:72051262-72051284 TGCACCTCCCCCACTGCAGCTGG - Intronic
1129183413 15:73891420-73891442 TGCGCCTCCCCCACTGCAGCTGG - Intergenic
1129605739 15:77024171-77024193 GGCTCCTCCCCGACCTCCTGAGG - Intronic
1131262195 15:90893272-90893294 GGGTCCTCCCCACCTGCAGGGGG + Exonic
1131403879 15:92147592-92147614 GGGTCCTGCTCCACTGCAGGAGG - Intronic
1132473371 16:119365-119387 TGCTCTGCCCCGACTGCTGGTGG + Intronic
1132601836 16:776240-776262 GGCTCCTTTCAGGCTGCAGGAGG - Intronic
1132604684 16:788787-788809 AGCTCCTCCCCAACGGCCGGGGG - Intronic
1132787764 16:1667468-1667490 GGCCACTCCAAGACTGCAGGTGG - Intronic
1132970693 16:2687089-2687111 CGCTCCTTCCCCACTGCAGCAGG + Intronic
1133276412 16:4640802-4640824 GGCACCTCCCCTCCTGCAGCCGG - Intronic
1134134074 16:11668395-11668417 GGCTCCTCCCCGGCTGGGGACGG - Exonic
1139587976 16:67916583-67916605 GGCTCCTCCCACAGTGCAGAGGG - Intronic
1141620668 16:85235284-85235306 GCCTCTTCCCCCACTGCTGGGGG + Intergenic
1141939102 16:87262888-87262910 GCCAGCTCCCAGACTGCAGGCGG + Intronic
1141992739 16:87619914-87619936 GGGGCCTCCCAGACTTCAGGAGG + Intronic
1142320428 16:89379003-89379025 GGCTTGTCTACGACTGCAGGAGG - Intronic
1142353091 16:89588656-89588678 GGCTCCCGGCCCACTGCAGGTGG + Exonic
1142372670 16:89691727-89691749 GGAGCCTCCCCTGCTGCAGGAGG - Intronic
1142683112 17:1561994-1562016 GGCTCAGCCGGGACTGCAGGCGG - Intronic
1143742668 17:8965722-8965744 GGCTCCGCCCCGCCCGCCGGAGG - Intergenic
1147954389 17:44124032-44124054 GTCCCCTCCCCGACCGCGGGAGG - Intergenic
1148110440 17:45141833-45141855 GGATATTCTCCGACTGCAGGAGG - Intronic
1148806015 17:50264405-50264427 GCCTGCTCCCCGGCTGCTGGCGG + Intergenic
1148835154 17:50462143-50462165 GGCTCCCCGCTGACTGGAGGTGG + Intronic
1149169336 17:53791646-53791668 CGCACCTCCCCCACTGCAGCTGG - Intergenic
1149695712 17:58614658-58614680 GGCTCCTCAACTTCTGCAGGAGG - Intronic
1150135132 17:62691198-62691220 GGCTGCTTCACAACTGCAGGGGG + Intronic
1151670459 17:75569202-75569224 GGCCCCTCCCCTTCTCCAGGTGG + Exonic
1152517327 17:80833304-80833326 GGCTCCTCCCCCCCAGCAGCTGG - Intronic
1152915319 17:83031687-83031709 GGCTCCACTCTGACTGCAGCAGG + Intronic
1154402191 18:14050785-14050807 GGCTTCTTCCCATCTGCAGGTGG + Intergenic
1157040709 18:44035826-44035848 GGCTCCTTCCCAATTGCAGGTGG + Intergenic
1157221053 18:45828732-45828754 GGCTCCCTGCCCACTGCAGGAGG - Intronic
1159334212 18:67043378-67043400 CGCGCCTCCCCCACTGCAGCTGG - Intergenic
1160567056 18:79792780-79792802 AGCTCCTCCCGCACTGCAGAAGG + Intergenic
1161007754 19:1944892-1944914 GGTTCCTGCCCCACTACAGGAGG - Intronic
1161154881 19:2727413-2727435 GCCTCCTTCCCACCTGCAGGGGG + Intronic
1161461603 19:4400742-4400764 GTCACCTCCACGACTCCAGGGGG - Intergenic
1161496851 19:4591215-4591237 GCCTGCTCTGCGACTGCAGGGGG + Intergenic
1162145227 19:8609285-8609307 CCCTCCTCCCCGAAGGCAGGAGG + Intronic
1162302104 19:9849980-9850002 GGGCCCTCCCGGACTGGAGGGGG + Intergenic
1162911053 19:13847874-13847896 GGATCCTCCCAGCCTGGAGGAGG + Intergenic
1163698257 19:18774784-18774806 GGAACCTCCCAGACGGCAGGAGG - Intronic
1165927608 19:39336639-39336661 TGCTCCTCCCCTCCTCCAGGTGG + Intronic
1167800247 19:51735962-51735984 GGGTCCTCCTTGTCTGCAGGTGG - Intergenic
925051497 2:819231-819253 GGCTCCTCTGAGCCTGCAGGTGG - Intergenic
925356331 2:3244077-3244099 AGCTCCTCCCAGGATGCAGGTGG + Intronic
925743025 2:7021557-7021579 GGCTCCTGCCACACTTCAGGTGG + Intronic
926547142 2:14255666-14255688 GGCGCCTCCCCCACAGCAGCCGG + Intergenic
928949781 2:36804396-36804418 GGCTCACCCCAGGCTGCAGGGGG + Intronic
929604844 2:43227156-43227178 GGCTCCAGCCCGACTGCACGTGG + Intergenic
929804419 2:45132268-45132290 GGCTCCTCTGCCACTGCAGCGGG - Intergenic
935088392 2:99870381-99870403 GGCCCCTTCCCCACAGCAGGTGG + Intronic
938228985 2:129641560-129641582 GGCCCCTCTCCCTCTGCAGGTGG + Intergenic
942045690 2:172098017-172098039 GGATTCTCCCCTACTGCAGAGGG - Intergenic
942320680 2:174733040-174733062 GGGTGATCCCCGACTTCAGGTGG - Intergenic
944653950 2:201859089-201859111 CTCCCCTCCCCCACTGCAGGAGG - Intronic
946495453 2:220191889-220191911 TGCGCCTCCCCCACTGCAGTTGG - Intergenic
947530065 2:230903336-230903358 GGCTTCCTCCTGACTGCAGGAGG + Intergenic
947623237 2:231604241-231604263 GTCTCCTCCCCCAGGGCAGGTGG + Intergenic
947740107 2:232481052-232481074 TGCTCCACCCCTGCTGCAGGAGG - Intronic
948460351 2:238127350-238127372 AGCTCCTCCCCTGCTGCAGGAGG + Intronic
948759143 2:240179730-240179752 GGCTCCTCCTGGGCTGCACGGGG - Intergenic
948880809 2:240856300-240856322 GGGTCCTCCCCGACAGGAGTGGG - Intergenic
949074089 2:242044281-242044303 GGCCCCTCCCCAACTTCTGGCGG - Intergenic
1172166703 20:32903912-32903934 GGCTCCTCCACCACTCCCGGGGG - Intronic
1173295030 20:41748491-41748513 GGCTCTGCCCAGACTCCAGGTGG + Intergenic
1173495479 20:43514763-43514785 GGCTCCTACCCGCCTGTTGGGGG - Exonic
1174249411 20:49207327-49207349 GGCTCCTCCAGGACAGAAGGGGG - Intergenic
1175401924 20:58705718-58705740 AGCTCCTTCCCAATTGCAGGTGG - Intronic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1175521541 20:59605219-59605241 CGCGGCTCCCCGAATGCAGGCGG - Intronic
1175696856 20:61109099-61109121 GGCTCCGCCACGAGGGCAGGGGG + Intergenic
1179509234 21:41861462-41861484 TGCTCCTCCCAAACTGCATGAGG - Intronic
1179973002 21:44846751-44846773 GGCTTCTCCCCATCTGCTGGAGG + Intergenic
1181063126 22:20291426-20291448 GGCCCCTCCCAGCCTGCAGGGGG + Intergenic
1183770423 22:39920490-39920512 AGCTGCACCCCGGCTGCAGGAGG - Intronic
1184688718 22:46107935-46107957 GGCTCCACCCCCACCGCAGGAGG - Intronic
1184799812 22:46752578-46752600 GGCCCCTCTACAACTGCAGGGGG - Intergenic
950043799 3:9937162-9937184 GAATCCTCCCACACTGCAGGTGG - Intronic
951879335 3:27464827-27464849 GGCTCTTCCCCCACTGCAAATGG - Intronic
952241124 3:31532561-31532583 AGCTCCGCCCGGACTCCAGGGGG + Intergenic
953360825 3:42294853-42294875 GGCCCTTCCCAGACTGCAGCAGG + Intergenic
956696340 3:71922272-71922294 GGGTCCTCCCCGAGCCCAGGTGG + Intergenic
957486581 3:80870418-80870440 TGCCCCTCCCCAACTGCAGCTGG - Intergenic
959985038 3:112562394-112562416 GACGCCTCCCCGACAGGAGGGGG - Intronic
961603139 3:128076061-128076083 GGCTCCTCCCTGGCGGCATGTGG + Intronic
962873821 3:139520256-139520278 GGCTTCACCCCAACAGCAGGGGG - Intronic
964198176 3:154088244-154088266 GCCTCCTCCCCCACTGCCGTGGG + Intergenic
968591560 4:1462267-1462289 GGCTGCTCTCCGACTCCAAGTGG + Intergenic
968685666 4:1956835-1956857 GGCTCCTGTGTGACTGCAGGCGG + Intronic
968898400 4:3418592-3418614 GGCTGCTCCCCGCCTGCAGGGGG + Intronic
968965346 4:3766560-3766582 GGCTGCGCCCCGGCTCCAGGAGG + Exonic
969325438 4:6441368-6441390 GGCTCCTCCCCTGCAGCTGGAGG - Intronic
971019067 4:22516099-22516121 GGCTCCTCCCCGCCCGCCGCCGG + Intergenic
971270530 4:25140229-25140251 TGCTCCTCCCTGACTCCAGGTGG - Intronic
971841565 4:31858993-31859015 ATCTCCTCCACCACTGCAGGTGG - Intergenic
973993471 4:56435005-56435027 GGCTCCTCCCCGACTGCAGGCGG - Intronic
978741735 4:112145368-112145390 GGCTCCGCCCCGACGGCCGGGGG + Intergenic
978850643 4:113331990-113332012 GGCTCCTCCCCCACTTAATGAGG + Exonic
982106971 4:152019708-152019730 AGCTCCTCCTCCCCTGCAGGTGG - Intergenic
985478280 5:91973-91995 GGCTCCTCCCCGAGCGCGGGCGG - Intergenic
986693540 5:10333139-10333161 GGCACCTGGCCGCCTGCAGGCGG - Intergenic
987181413 5:15372392-15372414 TGCGCCTCCCCGACTGAAGCTGG - Intergenic
987875285 5:23674322-23674344 CGCACCTCCCCCACTGAAGGTGG - Intergenic
991230746 5:64330755-64330777 TGTGCCTCCCCGACTGCAGCTGG - Intronic
994063596 5:95509456-95509478 GGCTCCTCCCCACCTGCAAATGG + Intronic
995458905 5:112381870-112381892 GGCTCCTCCCAAAGTGAAGGAGG + Intronic
996176629 5:120368004-120368026 TGCACCTCCCCCACTGCAGCTGG - Intergenic
997613575 5:135231522-135231544 AGCTGCTTCCCCACTGCAGGAGG + Intronic
997980193 5:138464093-138464115 GGCTCCCCAGGGACTGCAGGGGG + Intergenic
1001959463 5:175871649-175871671 GGCTCCGGCCCGACTCCACGAGG - Intronic
1002604980 5:180377620-180377642 GGCTCCTCTCCGACCCCAGCAGG - Intergenic
1005981944 6:30843425-30843447 GGCTCCTCCCCAACTGCACATGG - Intergenic
1006747745 6:36356694-36356716 GGGCCCTCCCCAACTGCTGGGGG + Intronic
1006766436 6:36510562-36510584 CGCACCTCCCCCACTGCAGCTGG + Intronic
1007264318 6:40585720-40585742 TGCTCCTCCCCAGCAGCAGGGGG + Intronic
1007272768 6:40650861-40650883 GCCTCATCCCCAACTCCAGGAGG + Intergenic
1007514723 6:42401879-42401901 GGCTCCTGTCTGCCTGCAGGTGG - Intronic
1011659392 6:89581410-89581432 GGCTCCTCACACACTGCTGGTGG - Intronic
1015750173 6:136550745-136550767 CGCTCGTCCCAGACTCCAGGAGG - Intronic
1017731841 6:157323784-157323806 CGCTCAGCCCCGACTGTAGGAGG + Intergenic
1018252101 6:161881526-161881548 GGCCCCTTACCGAGTGCAGGAGG - Intronic
1018634674 6:165850210-165850232 GGCGCCTCCCGGAGTCCAGGTGG - Intronic
1019159002 6:170057231-170057253 GGCTCCTCCCAGACGGCAGTGGG - Intergenic
1019473243 7:1232278-1232300 TCCTCCTCTCCGGCTGCAGGCGG - Intergenic
1019481587 7:1269543-1269565 GGCTCCTGCCCGACCGAGGGAGG + Intergenic
1019526918 7:1484658-1484680 GCCTTCTCCCCGACGCCAGGAGG - Intronic
1025262372 7:57427360-57427382 GGCTTCTCCCCGGCTGCCGCTGG - Intergenic
1025739730 7:64184602-64184624 GGCTTCTCCCCGGCTGCCGCTGG - Intronic
1027830564 7:83171727-83171749 GGCTGCTACCCAACTGCAGTTGG - Intergenic
1028640658 7:93039324-93039346 TGCACCTCCCCCACTGCAGCGGG - Intergenic
1029482671 7:100822664-100822686 GCCTCCCCCCCGCCGGCAGGTGG - Exonic
1030756210 7:113291112-113291134 TGCACCTCCCCTACTGCAGCCGG - Intergenic
1031786414 7:126040233-126040255 TGCGCCTCCCCCACTGCAGCTGG - Intergenic
1035165808 7:156989070-156989092 GGCTCCTTCCCCAGAGCAGGAGG - Intergenic
1038004244 8:23416521-23416543 GGCACCTCCTGGAGTGCAGGGGG - Intronic
1039381617 8:37091007-37091029 GGCTCCTTCCAGACAGCAGAGGG + Intergenic
1039802410 8:40970800-40970822 GGCTCCTCCCCTCCTGCAAATGG + Intergenic
1042281856 8:67064304-67064326 GGCCCCGCCCCCACTGCAGGCGG - Intronic
1044128209 8:88485060-88485082 GGCTTCTCCCCGCCTGCACCAGG + Intergenic
1046504122 8:115115139-115115161 TGCACCTCCCCCACTGCAGCTGG + Intergenic
1049562866 8:143320798-143320820 GGATCCTCCCCGAGTGTGGGCGG + Intronic
1050073456 9:1840260-1840282 TGCTCGTTCACGACTGCAGGAGG - Intergenic
1051376161 9:16404922-16404944 GGCTCCTCCACTAAGGCAGGAGG + Intergenic
1051667007 9:19475132-19475154 GCCTCCTTCCTGACAGCAGGTGG + Intergenic
1052596995 9:30574429-30574451 TGCACCTCCCCCACTGCAGCTGG - Intergenic
1053614049 9:39745129-39745151 GGCGCCTCCCCTGCTGCAGCCGG + Intergenic
1053872078 9:42503067-42503089 GGCGCCTCCCCTGCTGCAGCCGG + Intergenic
1054239467 9:62597264-62597286 GGCGCCTCCCCTGCTGCAGCCGG - Intergenic
1054260973 9:62864649-62864671 GGCGCCTCCCCTGCTGCAGCCGG + Intergenic
1054553599 9:66631791-66631813 GGCGCCTCCCCTGCTGCAGCCGG - Intergenic
1055401528 9:75929563-75929585 GGCACCTCCCCTACTGCAGCTGG - Intronic
1056994558 9:91443808-91443830 CGCACCTCCCCCACTGCAGCTGG + Intergenic
1057489728 9:95511362-95511384 TCCTCCTCCCCGGCTTCAGGGGG + Intronic
1058545933 9:106060087-106060109 TGCACCTCCCCCACTGCAGCCGG + Intergenic
1058660414 9:107261592-107261614 GTCTCCTCCCATATTGCAGGTGG - Intergenic
1060980109 9:127786626-127786648 CGCCCCTCCCCCACTACAGGAGG - Intronic
1061178490 9:129010893-129010915 GGCTGCTCCCCTCCTGCATGAGG - Intronic
1061624781 9:131835304-131835326 GGCGCCTCCCGGGCTGCCGGGGG + Intergenic
1061888108 9:133603253-133603275 GCCTCCTCCCCTACTGCTGTGGG + Intergenic
1061950116 9:133931409-133931431 GGGTGCTCCCTGCCTGCAGGAGG - Intronic
1061974649 9:134062108-134062130 GGCTCCTCCAGGGCTACAGGGGG - Intronic
1062048582 9:134435655-134435677 GGCTGCACCCCCACTGCAGGTGG - Intronic
1062108269 9:134767380-134767402 GGCCACTGCCCGCCTGCAGGTGG + Intronic
1062234278 9:135500601-135500623 GGCTCCTCCGGGCCTGTAGGCGG + Exonic
1062395224 9:136350091-136350113 GGCTCTTCCCAGCCTTCAGGTGG + Intronic
1062596225 9:137301106-137301128 GGCTGCTCCTCGGCTGCAGCCGG + Exonic
1185659262 X:1714034-1714056 GGCTCCTCCTCCTCTGCAGATGG - Intergenic
1186334755 X:8574238-8574260 GGCTCCTTTCCTGCTGCAGGTGG + Intronic
1189323042 X:40097654-40097676 GGCTCCTGCCCGAGCGCGGGCGG - Intronic
1200179857 X:154143712-154143734 GGCTCCTCCTCCAGTGTAGGGGG - Intergenic
1201349398 Y:13023329-13023351 GGCTCCTCCCCTAGTCAAGGGGG + Intergenic