ID: 973993471

View in Genome Browser
Species Human (GRCh38)
Location 4:56435005-56435027
Sequence GGCTCCTCCCCGACTGCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 224}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973993471_973993476 4 Left 973993471 4:56435005-56435027 CCGCCTGCAGTCGGGGAGGAGCC 0: 1
1: 0
2: 1
3: 17
4: 224
Right 973993476 4:56435032-56435054 CCCAGCTAGACCAAGCAAACCGG 0: 1
1: 0
2: 0
3: 7
4: 104
973993471_973993482 30 Left 973993471 4:56435005-56435027 CCGCCTGCAGTCGGGGAGGAGCC 0: 1
1: 0
2: 1
3: 17
4: 224
Right 973993482 4:56435058-56435080 TTTACAAGCTGGCCAGCCTCTGG 0: 1
1: 0
2: 3
3: 43
4: 522
973993471_973993480 19 Left 973993471 4:56435005-56435027 CCGCCTGCAGTCGGGGAGGAGCC 0: 1
1: 0
2: 1
3: 17
4: 224
Right 973993480 4:56435047-56435069 CAAACCGGCGGTTTACAAGCTGG 0: 1
1: 0
2: 0
3: 1
4: 24
973993471_973993478 7 Left 973993471 4:56435005-56435027 CCGCCTGCAGTCGGGGAGGAGCC 0: 1
1: 0
2: 1
3: 17
4: 224
Right 973993478 4:56435035-56435057 AGCTAGACCAAGCAAACCGGCGG 0: 1
1: 0
2: 1
3: 3
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973993471 Original CRISPR GGCTCCTCCCCGACTGCAGG CGG (reversed) Intronic