ID: 973996225

View in Genome Browser
Species Human (GRCh38)
Location 4:56462124-56462146
Sequence ATGAAGAATCAAAATGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 626}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973996221_973996225 22 Left 973996221 4:56462079-56462101 CCATAAAAAGGTAAACAGTATAA 0: 1
1: 0
2: 1
3: 50
4: 575
Right 973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG 0: 1
1: 0
2: 3
3: 49
4: 626

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973996225 Original CRISPR ATGAAGAATCAAAATGAGGA CGG Intergenic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900731502 1:4264580-4264602 ATGATGAATCAAAGAGTGGAAGG + Intergenic
901259070 1:7857948-7857970 ATGAAGTCTCACAAAGAGGAAGG + Intergenic
901775332 1:11556726-11556748 CCGCAGAATCAAAAGGAGGATGG + Intergenic
902529870 1:17084042-17084064 ATGAACAAATAAAATGAGGGGGG + Intronic
903257605 1:22113457-22113479 GTGAGGAACCAAATTGAGGATGG + Intergenic
904114477 1:28151472-28151494 ATTAAGATTCAACATGAGGCCGG - Intronic
905334815 1:37237339-37237361 ATGAGGAATCAGAATGAGCGTGG + Intergenic
905785104 1:40749216-40749238 AAGGAGAAACAATATGAGGAAGG - Intronic
906336112 1:44932684-44932706 ATCAAGAATCAGAATGATGTTGG + Intronic
907832617 1:58079322-58079344 ATGAGCACTCCAAATGAGGATGG - Intronic
907854224 1:58285708-58285730 AGGAAGAATCAATATGAAAATGG + Intronic
908943445 1:69464909-69464931 AGGAAGAATCAATATGAAAATGG - Intergenic
909950081 1:81708709-81708731 TTGAAGCATAAAAATTAGGATGG + Intronic
909972740 1:82009730-82009752 AAGAGAAATAAAAATGAGGATGG - Intergenic
910107447 1:83646752-83646774 ATGGAGAATAAACATGAGTAGGG - Intergenic
910363256 1:86436383-86436405 ATGAAGAATAAAATAAAGGAAGG - Intronic
910902485 1:92136405-92136427 CTAAAGAAACAAAATGAGGAAGG - Intronic
911233271 1:95382735-95382757 GTGAGGAATCAAATTGTGGATGG + Intergenic
911837718 1:102642842-102642864 AGGAAGAATCAATATGAAAATGG + Intergenic
911931287 1:103907272-103907294 TTTAAGAATAAAAATGAGAAGGG - Intergenic
912061907 1:105684693-105684715 ATTAAGAATGAAAATATGGAAGG + Intergenic
912063575 1:105706024-105706046 ATAAAAAATCAAATTGAGGACGG + Intergenic
912164651 1:107028858-107028880 GTGAAGAATAATAATGAAGAAGG + Intergenic
912219095 1:107651523-107651545 AGGAAGAAACAAAGTAAGGAAGG + Intronic
912558721 1:110535026-110535048 ATAAAGAATAATAATGATGATGG - Intergenic
912712645 1:111960834-111960856 ATGAAGAATTAAAACCATGAGGG - Intronic
912817770 1:112843285-112843307 ATGAATAATCAAAATAATCAGGG - Intergenic
912998233 1:114553168-114553190 ATCAAGAAACAAAGTGGGGAAGG + Intergenic
913435606 1:118844538-118844560 ATGAAGGAGCTAAATGATGATGG - Intergenic
913477378 1:119251454-119251476 ATTAAAAATCAAAAAGAGGCCGG + Intergenic
913559627 1:120004606-120004628 ATGAAGAAGCAAAAGGAACAGGG + Intronic
913638233 1:120785935-120785957 ATGAAGAAGCAAAAGGAACAGGG - Intergenic
914280215 1:146164027-146164049 ATGAAGAAGCAAAAGGAACAGGG + Intronic
914541260 1:148614966-148614988 ATGAAGAAGCAAAAGGAACAGGG + Intronic
914625380 1:149456279-149456301 ATGAAGAAGCAAAAGGAACAGGG - Intergenic
914863228 1:151403878-151403900 ATGAAGACTCAAACTGGGAATGG + Exonic
915703308 1:157818892-157818914 ATGAAGAAACATATTGATGATGG + Intronic
916212466 1:162369994-162370016 TAGAAGAATGAAAAAGAGGAAGG - Exonic
916264323 1:162875433-162875455 ATAAGGAATCAAAAGGAGGATGG - Intergenic
916286916 1:163117366-163117388 ATCAAGTGTCAAAATGAGGATGG + Intronic
916350549 1:163844844-163844866 ATTAAGAACCAATATGAGGAAGG - Intergenic
916866682 1:168867342-168867364 ATGAGGAATCAATATCAGAAGGG - Intergenic
917218574 1:172703506-172703528 ATGAAGAATAAAGTGGAGGATGG + Intergenic
917816373 1:178713785-178713807 ATTAAAAACCAAAAAGAGGACGG + Intergenic
918606147 1:186428652-186428674 ATGATTAAGCTAAATGAGGAAGG - Intergenic
919062508 1:192651605-192651627 AGGAAGAAGCAAAAGTAGGAGGG + Intronic
919164714 1:193877373-193877395 AGGAAGAATCAATATGAAAATGG - Intergenic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
919704578 1:200664292-200664314 ATGAAAGATCAAAATGGGGCTGG + Intronic
920622921 1:207565990-207566012 TTGAAGAATCACATTGAGGGAGG - Intronic
920749767 1:208662679-208662701 ATGAAGAATCAGATTGTGCAGGG - Intergenic
921107282 1:211995107-211995129 ATTAAGAATGAAAATTATGATGG - Intronic
921560267 1:216649349-216649371 TTGGTGAATGAAAATGAGGATGG - Intronic
921562753 1:216677945-216677967 TTGCAGCATCAGAATGAGGAAGG - Intronic
921703757 1:218296070-218296092 AGGTAAAATCAGAATGAGGATGG + Intronic
921740438 1:218678543-218678565 ATGAGGAAATAAAAGGAGGAAGG - Intergenic
922601279 1:226856504-226856526 AGGAAGACTCAAAGTGGGGAAGG - Intergenic
922895529 1:229097177-229097199 AAGAAGAGCCAAAATCAGGAAGG + Intergenic
922924746 1:229339300-229339322 ATCAAGAATCATAACGAGGCAGG + Intronic
923079215 1:230637743-230637765 ATCAAGAAACAAAATGAAGGAGG + Intergenic
923374117 1:233342903-233342925 ATGAAGAATCCGATTTAGGATGG - Intronic
923735558 1:236603720-236603742 ATGAAGAAACAAAATTAGAGAGG - Intronic
923951394 1:238959505-238959527 CTGAAGAATTTAAATTAGGAAGG - Intergenic
924195921 1:241606773-241606795 ATGAAGAATGAAAATAAGACTGG + Intronic
1063049429 10:2430813-2430835 AGGAAGAAAGAAAATAAGGAAGG + Intergenic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1065406216 10:25368771-25368793 AGGAAGAATCAATATGAAAATGG - Intronic
1065452907 10:25877431-25877453 GTGAACAATCAAATTGTGGAAGG + Intergenic
1065775670 10:29117418-29117440 ATAAAAAATGAAAATGAGGAGGG + Intergenic
1065978475 10:30865449-30865471 ATGAAGAAAAAAAATGACAAAGG + Intronic
1067521211 10:47007773-47007795 TTGAAGAAAGAAAATGGGGAGGG + Intergenic
1068186708 10:53594349-53594371 ATGAAGAATGAAGAAAAGGAGGG - Intergenic
1068690371 10:59907361-59907383 ATGAAGAAAAAAAAAAAGGAAGG + Intergenic
1068691656 10:59922040-59922062 ACAAAGAATGAAAATGAGGGGGG - Intergenic
1068809052 10:61235175-61235197 AGAAAGACTCAAAATGGGGAGGG - Intergenic
1069110242 10:64437980-64438002 AGCAAGAATCAATATGAGCATGG + Intergenic
1069194298 10:65529418-65529440 ATGAACTTTTAAAATGAGGAGGG - Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070385633 10:75921836-75921858 AGGAAGGATCAGAAGGAGGAAGG - Intronic
1071148994 10:82610697-82610719 AAGAAGAATACAAATGAGTAAGG - Intronic
1071332771 10:84576231-84576253 ATGGAGAAGAAAAACGAGGAGGG - Intergenic
1071386887 10:85130278-85130300 AGGAAGAATCAATATCATGAAGG + Intergenic
1071492556 10:86145760-86145782 ATAAAGAACACAAATGAGGAAGG - Intronic
1071542242 10:86496560-86496582 ATGGATAAACAAAATGTGGAAGG + Intronic
1071952273 10:90717372-90717394 ATGAAGAAGGAAAAGGAGCATGG + Intergenic
1072161710 10:92772987-92773009 TTGAAAAATAAAAATGAGCATGG - Intergenic
1072168960 10:92842062-92842084 ATGAAGAATAAAAACCAGGCCGG + Intronic
1072210857 10:93245977-93245999 AACAATAATCAAAATCAGGATGG + Intergenic
1072363682 10:94686791-94686813 AGGTAGAATCAAAATGATAAAGG + Intronic
1073001208 10:100287383-100287405 TTGAAGGTGCAAAATGAGGAGGG + Intergenic
1076211724 10:128652406-128652428 ATGAAGAATCAAGAAGAAGGGGG + Intergenic
1078313486 11:10270695-10270717 TTTAAGAAGTAAAATGAGGACGG + Intronic
1078381897 11:10849981-10850003 ATCAAGAACCAAAATGGGTACGG + Intronic
1078892173 11:15567295-15567317 AGGAAGAAAGAAAAGGAGGAAGG - Intergenic
1078922813 11:15846066-15846088 AAGAAGAATGGAATTGAGGAGGG - Intergenic
1078935075 11:15942654-15942676 AGGAAGAAGCAAAAGGAAGAAGG + Intergenic
1079536790 11:21524872-21524894 ATGAGGAATGACAGTGAGGAAGG + Intronic
1079768502 11:24426658-24426680 ATGAACAATCAAAAGGGAGAAGG + Intergenic
1079859147 11:25645374-25645396 AGGAAGAATCAATATGAAAATGG - Intergenic
1080124372 11:28714374-28714396 ATGTAGAATCTAATTGAGCATGG + Intergenic
1080282677 11:30576455-30576477 ATGAAGAATTAACCTGAGTAGGG + Intronic
1080340070 11:31251941-31251963 ATGAAGAAACCAAATCATGAAGG + Intronic
1080651247 11:34224304-34224326 ATGAAAAATTAAAATTAGGCTGG - Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1080717159 11:34814277-34814299 ATAAAAAATCAAAATGTGGGGGG + Intergenic
1080793161 11:35539086-35539108 AAGAATAATCAAATTGATGAGGG + Intergenic
1081174886 11:39915103-39915125 AGGAAAAATCAAACTGAGAAAGG + Intergenic
1081514962 11:43819626-43819648 ATGAAGAATGAAGAAGAGGAAGG - Intronic
1082131640 11:48497010-48497032 CTGAAGAATCTTAGTGAGGAAGG + Intergenic
1083323427 11:61861504-61861526 ATATGGAAACAAAATGAGGATGG - Intronic
1084554433 11:69867530-69867552 ATGGAGCATCAGAATGGGGAAGG - Intergenic
1084841716 11:71856968-71856990 ATGTAGAATCAAACTGAAAAGGG + Intergenic
1085240499 11:75050161-75050183 AGGAAGACTCAAAGTGGGGAGGG - Intergenic
1085557719 11:77440503-77440525 ATGAGGAAACAAACTGAGAAAGG + Intronic
1086268529 11:85030766-85030788 ATTAAGTATCAATATGAGGTGGG - Intronic
1086287703 11:85268353-85268375 AGGAAGACTCAAAGTGGGGAGGG - Intronic
1086554992 11:88098883-88098905 ATGAAGACCCAAAATGAAAATGG - Intergenic
1087047703 11:93857025-93857047 AGGAAGACTCAAAGTGGGGAGGG + Intergenic
1087065091 11:94020667-94020689 AGGATGAATGAAAATGATGATGG - Intergenic
1087260215 11:96002665-96002687 ATGAAGAATAATGATGGGGATGG + Intronic
1088245260 11:107812228-107812250 ATGAAGAATGGAAACTAGGAGGG - Intronic
1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG + Intergenic
1090161017 11:124495636-124495658 ATGAAGAATCACTTGGAGGAGGG - Intergenic
1091166718 11:133482783-133482805 ATTAAAAATTAAAATGATGAGGG + Intronic
1091188056 11:133664379-133664401 ATGAAGATTCTACATGAGGGAGG - Intergenic
1091646858 12:2279364-2279386 ATGAAAAATCACAAAGATGAAGG - Intronic
1093396300 12:18686982-18687004 ATGAAGATTCAAGTAGAGGATGG + Intronic
1094241141 12:28226182-28226204 ATGAAGATTCATTATGAGGTAGG + Exonic
1094354413 12:29562912-29562934 ATGAAAAATCCATGTGAGGAAGG - Intronic
1095518889 12:43038332-43038354 GTGAAGAAAGAACATGAGGAAGG - Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096381702 12:51163907-51163929 ATAAAGAATAAAAATAAGGCAGG + Intronic
1096479932 12:51933316-51933338 ATGAAGAATCAAAGTCAGCGTGG - Intergenic
1097148220 12:56956228-56956250 ATGATGAATAAAAAGCAGGAAGG + Intronic
1097935335 12:65243042-65243064 CTGAAGAATAAAAATTAGCAGGG - Intronic
1098563741 12:71907515-71907537 ATGATGAAAATAAATGAGGATGG + Intronic
1098692543 12:73506400-73506422 ATGAAGACTCCAAATCAGAAGGG - Intergenic
1098941697 12:76544267-76544289 ATTAAGGATCAAAATGAAGAAGG - Intronic
1098964854 12:76777133-76777155 ATGAAGAATCCTTATGGGGAAGG - Intronic
1099057624 12:77864834-77864856 ATCAAGAATCAAAAAGAACAAGG - Intronic
1099466711 12:82997136-82997158 GGGAAGTATCAAAATGATGAGGG - Intronic
1099938035 12:89151387-89151409 ATGAAGACTCAGAATGGGGAGGG + Intergenic
1100023867 12:90103932-90103954 ATGAAGAAAAAAAATCAAGAAGG - Intergenic
1100027041 12:90142948-90142970 ATGAAGAATCCAAATGGTGATGG - Intergenic
1100134570 12:91539241-91539263 AGGAAGCATCACAATGCGGATGG - Intergenic
1100715472 12:97301159-97301181 ATGGACAATAAAAATGTGGAAGG - Intergenic
1101278895 12:103229642-103229664 ATGGAAAATAAAAATGTGGAAGG - Intergenic
1101538882 12:105646247-105646269 CTGATGAAACAAAATGAGGCTGG + Intergenic
1101638836 12:106570587-106570609 AGGAAGAAACAAAAGAAGGAAGG - Intronic
1101677603 12:106932686-106932708 ATGATGAAGCATAATGAGAAAGG + Intergenic
1103894637 12:124264892-124264914 AGCAAGAATAAAAAGGAGGAAGG - Intronic
1104121990 12:125808573-125808595 ATGCAAAATTAATATGAGGAGGG - Intergenic
1104159374 12:126163759-126163781 AGGAAGAAGAAAAAGGAGGAGGG + Intergenic
1104323611 12:127774767-127774789 ATGCAAAATTAATATGAGGAGGG + Intergenic
1104878853 12:132055406-132055428 ATGAGGGATGAAAATGAGGTGGG + Intronic
1105032446 12:132893296-132893318 ATGAAGAATTATCATGAGGTAGG - Intronic
1106014974 13:25860335-25860357 ATAAATAATAATAATGAGGAAGG - Intronic
1106062960 13:26312781-26312803 ATAAAGAATCAAAACGAGATAGG - Intronic
1106390223 13:29328382-29328404 ATCATAAATCAATATGAGGAAGG + Intronic
1106752420 13:32788649-32788671 ATGATGTATCACAATGATGATGG - Intergenic
1106904695 13:34392791-34392813 ATCAAAATTCAAATTGAGGATGG - Intergenic
1107063716 13:36189086-36189108 AGGAAGAATCAGCATGAGCATGG - Intronic
1107512405 13:41097757-41097779 AGGAAGAATCAATATGAAAATGG - Intergenic
1108042886 13:46355937-46355959 ATAAAGAAAAAAAATAAGGATGG + Intronic
1108497544 13:51040395-51040417 AAGAAGACTCTAAATTAGGAGGG + Intergenic
1108682820 13:52794069-52794091 ATGAAGAATCAAAGTGCGCTGGG - Intergenic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1109154425 13:58888347-58888369 ATGAAGAACTGAAATGTGGAGGG + Intergenic
1109428186 13:62195901-62195923 ATGAAAAATCAAAATGAACCTGG - Intergenic
1109615819 13:64832558-64832580 AGGAAGAATCAATATGAAAATGG + Intergenic
1109986525 13:69993492-69993514 ACGAAGAATGAAAAAGAGGTCGG + Intronic
1110012331 13:70352849-70352871 ATGAGGATACAAAATGATGAGGG - Intergenic
1110554291 13:76840858-76840880 ATGTAGAAGCAAAATGAGTGTGG + Intergenic
1110969321 13:81740948-81740970 AGGAAGACTCAAAGTGGGGAGGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111520855 13:89401834-89401856 TTGAAGGATGAAAATAAGGAAGG - Intergenic
1112196197 13:97228878-97228900 ATGAAAACTCAAATTGAGTAAGG + Intronic
1112997837 13:105596221-105596243 ATGAGAAATCTAAATGAGAAAGG + Intergenic
1113002236 13:105654600-105654622 AGGAAAAATGTAAATGAGGATGG + Intergenic
1113021709 13:105894846-105894868 TGGAAGAATGAAAAGGAGGAAGG - Intergenic
1113322226 13:109245223-109245245 ATGAAGAAAGAAAATGAGAAGGG - Intergenic
1113616820 13:111686074-111686096 ATGATGGATAAAAATGAGAAAGG - Intergenic
1113622350 13:111771345-111771367 ATGATGGATAAAAATGAGAAAGG - Intergenic
1114377484 14:22163747-22163769 ATTAAGGATAAAAATGAAGATGG + Intergenic
1114441177 14:22749331-22749353 TTGCAGAATCAAAAGAAGGAAGG + Intergenic
1114488980 14:23084308-23084330 TTAAAAAATCAAAATGAGGCTGG + Intronic
1114685820 14:24530447-24530469 AGGAAGAATCAATATGAAAATGG + Intergenic
1114817427 14:25977061-25977083 ATGAAAAAGCAAGATGGGGAAGG + Intergenic
1115459514 14:33644784-33644806 ATCAAGAATAAAGATGAGGCCGG + Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116035189 14:39618935-39618957 AAAAAGAAGCAAAATGAGGTCGG - Intergenic
1116637863 14:47420306-47420328 ATAAAGAATTCAAATGTGGAAGG + Intronic
1116906111 14:50405201-50405223 ATGAAGAAAGAAAATGTGGCTGG - Intronic
1117548261 14:56810309-56810331 TTAAAGAACGAAAATGAGGAAGG + Intronic
1117922403 14:60738829-60738851 ATTAAGAGCCAAAATGAGGCTGG - Intronic
1117953974 14:61108634-61108656 TTGAAGAGTTAAAATGAGAATGG + Intergenic
1118554930 14:67007829-67007851 ATGATGAATGAAAAAGAGGGAGG + Intronic
1118803362 14:69211913-69211935 ATCAAAAGTCAAAATGAGGTGGG - Intronic
1118881822 14:69834308-69834330 ATCAAGAAAAAAAATGAGAATGG - Intergenic
1119531886 14:75367557-75367579 ATGAAGAAGGAAAAAAAGGAAGG + Intergenic
1120690892 14:87591059-87591081 ATGAGGAAGGAAAATGAGGATGG + Intergenic
1121171097 14:91855084-91855106 ATGAAGAAACAAGTTGAGCAGGG + Intronic
1121193073 14:92046843-92046865 ATGAAGAATTATACTGAGGTAGG + Exonic
1121812645 14:96904949-96904971 AATAAGAATCCAAATGAGGTTGG + Intronic
1122436007 14:101699715-101699737 ATGAAGTAACAAAAACAGGATGG + Intergenic
1126146364 15:45476440-45476462 ATAAAGAAGCAAAAAGAGGATGG + Intergenic
1126343088 15:47665306-47665328 AAGAAGAATGAAAAGGAAGATGG - Intronic
1126378948 15:48026413-48026435 ATGAAGAAGCAAAATAAAAAAGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1128324323 15:66713906-66713928 ATGAAGAATCAAACTGAGTGAGG + Intronic
1129066201 15:72906423-72906445 ATTAAGAATAAAACTGAGGCTGG + Intergenic
1129089363 15:73132349-73132371 GTGAAGAAACAAAAAAAGGATGG - Intronic
1129553470 15:76479161-76479183 ATGAGGAAAAAAAAGGAGGAGGG + Intronic
1130301847 15:82686094-82686116 AAGAAGACACAAAATCAGGAGGG + Intronic
1131662872 15:94537607-94537629 ATGAAAAATGAAAAGGAGGTAGG + Intergenic
1131938190 15:97531195-97531217 ATAAAGAAGGAAAATGAGGTAGG + Intergenic
1132169319 15:99631773-99631795 ATGAAGAAATAAAATAATGAGGG + Intronic
1132219049 15:100091276-100091298 ATGAAGAATAATTATGAGGTAGG + Intronic
1133597978 16:7311275-7311297 AAACAGAATCAAAATTAGGAAGG + Intronic
1133602087 16:7349593-7349615 CCTCAGAATCAAAATGAGGATGG + Intronic
1133630236 16:7613538-7613560 ATGAAGTTTAAAAATGAAGAGGG + Intronic
1134194837 16:12151664-12151686 ATGTAAAACCATAATGAGGAGGG - Intronic
1134785131 16:16935298-16935320 ATGAATAATAAAAATGGGGCCGG - Intergenic
1135803824 16:25523846-25523868 ATAAAAAATTAAAATTAGGAAGG - Intergenic
1136158466 16:28401717-28401739 AGGAGGAGTCAAAAAGAGGATGG - Intronic
1136204621 16:28713566-28713588 AGGAGGAGTCAAAAAGAGGATGG + Intronic
1137002070 16:35237837-35237859 ATGCAGAATCAGAATGAAGTAGG - Intergenic
1137352795 16:47728544-47728566 AGGAAAAATCCAAATGAAGAAGG - Intergenic
1137820732 16:51442788-51442810 ATGGAGAATCAAATAGAGAAGGG + Intergenic
1138234136 16:55366152-55366174 ATGAAGAATGAAAATGCCTAAGG + Intergenic
1138467752 16:57204941-57204963 AGAAAGAAACAAAATGTGGATGG + Exonic
1138810788 16:60148077-60148099 AGGAAGAATCAATATGAAAATGG + Intergenic
1138832799 16:60395473-60395495 ATGAAGAATAAAATTAAGGCTGG + Intergenic
1138847429 16:60583579-60583601 ATGAAGAATCAAGATGATGAAGG + Intergenic
1139156618 16:64450840-64450862 ATGAGGAACCAAAAAGATGAGGG + Intergenic
1139308094 16:66005265-66005287 ATAAAGAAAGAAAGTGAGGAGGG - Intergenic
1139556035 16:67711074-67711096 ATGAAGACTCCAAAAGAGGTAGG + Intronic
1139946301 16:70644798-70644820 AGGAGGAATGAAAAGGAGGAAGG + Intronic
1140452034 16:75078713-75078735 GTGAAAAGTCAAAATGAAGAAGG + Intronic
1140521230 16:75583860-75583882 ATGAAACATCAAATTCAGGATGG + Intergenic
1140553020 16:75887780-75887802 ATAAAGAAGAAAAATGATGAAGG + Intergenic
1140874842 16:79141226-79141248 AGGAAGACTTGAAATGAGGAGGG - Intronic
1141544148 16:84752465-84752487 TAAAAGAATAAAAATGAGGAAGG - Intronic
1141855054 16:86675110-86675132 GTTAAGAATCAAGATGAGGCTGG - Intergenic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1144397488 17:14859084-14859106 AGGAAGAATCAATATGAAAATGG + Intergenic
1144603328 17:16638980-16639002 ATGAATCATCACAATAAGGAAGG + Intronic
1147570836 17:41569854-41569876 AAGAAGAATCATAAGGAGGTAGG - Exonic
1148444591 17:47729803-47729825 ATGAAGACTCAAAATGAGAGAGG - Intergenic
1149014107 17:51888218-51888240 AGGAAGTAACAAAAGGAGGAAGG + Intronic
1149403874 17:56327157-56327179 ATGAAGAAACCAAGTGAGTATGG - Intronic
1151122740 17:71810529-71810551 ATGGAAAACCAAAACGAGGAGGG + Intergenic
1151142934 17:72012302-72012324 ATAAAGAAGCAAAATGATTAGGG + Intergenic
1151374714 17:73679283-73679305 TTGAATAATCAAACTGATGAAGG - Intergenic
1152836871 17:82538922-82538944 AAGAAGAATCAAAATTCTGAAGG - Intronic
1152907767 17:82978259-82978281 ATTAGGAAGCAAACTGAGGAAGG - Intronic
1152939722 17:83161798-83161820 ACGATGAATCACAATGAGAAGGG - Intergenic
1153231459 18:2940793-2940815 ACAAACAATCAAAATGAAGAGGG + Intronic
1154104054 18:11504946-11504968 ATGAAGCATGGAAAGGAGGAAGG + Intergenic
1154505807 18:15039872-15039894 ATGAAGGAACAAAATGAAGTTGG + Intergenic
1156580826 18:38372961-38372983 ATCAAAAATCAAGATGAAGAGGG + Intergenic
1156759102 18:40565604-40565626 ATGAATAATCAAGAAAAGGAGGG - Intergenic
1158234225 18:55295035-55295057 ATGGAGAATCAAAAACAGGTTGG + Intronic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1159733018 18:72055352-72055374 ATGAACAAGGAAAGTGAGGAAGG - Intergenic
1161506549 19:4647083-4647105 ATGAATAAACAAAATGAGATCGG - Intronic
1163092996 19:15034291-15034313 ACAAAGGATCAAAAGGAGGAAGG + Intergenic
1163322571 19:16583212-16583234 AGGGAGAATCCAAAGGAGGAGGG - Intronic
1163453527 19:17392976-17392998 ATTAAAAATCAAAATGGGGCCGG - Intergenic
1164085252 19:21895570-21895592 AGGAAGAATCAATATGAAAATGG - Intergenic
1164485408 19:28651656-28651678 CTGAAGAATAAAAATGGTGAGGG - Intergenic
1164948266 19:32314403-32314425 ATAAATAATAAAAATGAAGATGG + Intergenic
1165501904 19:36196224-36196246 ATTAAAAATCAAAATTAGGCTGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1166602117 19:44105674-44105696 ATGGAGACTCAAAATGGGGAGGG - Intronic
1167205101 19:48096153-48096175 ACAAAGGATGAAAATGAGGAGGG + Intronic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
924973219 2:150430-150452 AGGAAGACTCAAAGGGAGGAAGG - Intergenic
925441034 2:3885466-3885488 ATGAAGAAGTGAAAGGAGGAAGG - Intergenic
925456516 2:4021105-4021127 ATGAAGAATTAACGTGAGGGTGG - Intergenic
926241059 2:11085772-11085794 ATGAAGAGGCAAAATGAATATGG - Intergenic
926853458 2:17226635-17226657 AGGAAGAAAGAAAAAGAGGAGGG + Intergenic
927337369 2:21940828-21940850 ATCATAAATCAAAAAGAGGAAGG - Intergenic
927490829 2:23519799-23519821 AGGAAGACCCAAAGTGAGGAGGG + Intronic
927617260 2:24611738-24611760 ATGAAAAATAAAAAGGAGCAGGG - Intronic
929353261 2:40987168-40987190 CAGAAGAATCTAAATGAGAAAGG - Intergenic
929372725 2:41246215-41246237 ATAAATAATGAAAATGAAGAAGG + Intergenic
929868832 2:45740772-45740794 AGGTAGAATCAGAATGAGGCAGG - Intronic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930244785 2:48972357-48972379 CTGAAGAATCATAATAGGGAGGG - Intronic
930624306 2:53679469-53679491 ATGGAGAAGAAAGATGAGGATGG - Intronic
932156957 2:69426773-69426795 ATGAATAATCATAATGAAGGGGG + Intronic
933151640 2:78922296-78922318 AAGAAGAATCAAAACAAGTAAGG - Intergenic
934064220 2:88325052-88325074 AAGCAGAATCAACATGAGAAAGG + Intergenic
935097554 2:99960404-99960426 ATGAAGTATCAGAATGACTACGG - Intronic
935551182 2:104457066-104457088 ATGTAAAATGAAAATGAGTATGG - Intergenic
936596819 2:113856012-113856034 ATGAAGATTCAGAAAGTGGAAGG + Intergenic
936848054 2:116861616-116861638 ATGAAATAAGAAAATGAGGAAGG - Intergenic
937715979 2:125033092-125033114 ATGTAAAAACAAAGTGAGGAAGG - Intergenic
938200821 2:129371700-129371722 ATGAAGACTCATAATGGGGAGGG - Intergenic
938251544 2:129819658-129819680 AAAAAGAATAAAAATGAGAATGG + Intergenic
938657909 2:133453725-133453747 AGGAAGAAACAAAAGAAGGAAGG + Intronic
939204188 2:139078794-139078816 ATGAAAAAGCAAAAGAAGGAGGG - Intergenic
939430451 2:142099074-142099096 ATATAGAATAAAAATGAGAATGG + Intronic
939467551 2:142578404-142578426 ATGAAGAAGCCAAAGGAGGATGG - Intergenic
939468212 2:142585393-142585415 ATGAAGAATAACCATGAAGATGG + Intergenic
939798311 2:146676338-146676360 ATGAAAAATCAAGTTGAGAATGG + Intergenic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940574868 2:155489964-155489986 ATGAAGAATGAAAAGGAAGATGG + Intergenic
940631514 2:156245247-156245269 ATTAAGAATGAAAATGTGGCCGG - Intergenic
940777393 2:157899147-157899169 ATGATGAATGGAAATGATGAGGG - Intronic
940841870 2:158593136-158593158 TAGAAGAATAGAAATGAGGAAGG + Intronic
940880042 2:158937496-158937518 CTGAAAAAACAAGATGAGGAGGG - Intergenic
941172778 2:162159990-162160012 ATGAAGAGGCAAGATGAGGCTGG + Intergenic
941337639 2:164265526-164265548 AGGAAGAATCAATATGAAAATGG + Intergenic
941350245 2:164423762-164423784 ATGTAGACTCAAAATAAAGAAGG - Intergenic
941604656 2:167582604-167582626 ATGAAGGATCAAAATAAAAAAGG - Intergenic
941858826 2:170256921-170256943 ATGAAAAATAAAAAAGAGCAGGG + Intronic
942389333 2:175476000-175476022 ATGAATATTCAAAATGAGGCGGG + Intergenic
942798862 2:179852967-179852989 TTTAAGACTCAAAATGAAGAAGG - Intronic
943332260 2:186573523-186573545 ATTAAGAGGAAAAATGAGGAAGG + Intergenic
943587106 2:189754140-189754162 ATGAAAAAGGAAAAAGAGGAAGG - Exonic
944276393 2:197843298-197843320 ATGAAGAATGTAAAGCAGGAGGG - Intronic
945905631 2:215589585-215589607 ATGAAAAATTAAAATTTGGAGGG - Intergenic
946463663 2:219892192-219892214 AAGAGGAAGGAAAATGAGGAGGG + Intergenic
946540793 2:220682325-220682347 ATGAAGAATAAAAAGGGGGCTGG - Intergenic
946655411 2:221940504-221940526 CTCAAGAGCCAAAATGAGGAGGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
946996459 2:225397887-225397909 AAGAAGAAACAAAACAAGGAAGG + Intergenic
947150041 2:227106424-227106446 ATGAAGAATTAAAATGTAAAAGG + Intronic
947182303 2:227422010-227422032 ATTAAGAAGCAAAATGAGGCTGG - Intergenic
947245792 2:228046905-228046927 ATGTGGAATCATAATGAGGTTGG - Intronic
947304907 2:228734776-228734798 ATGCAGAATCATAAAGAGTAGGG - Intergenic
1169203457 20:3727249-3727271 ATGCAGAATCAAAATGGAGTGGG - Intergenic
1169303723 20:4469919-4469941 GTCAATAATCACAATGAGGAAGG + Intergenic
1169398972 20:5263429-5263451 GTGATGAATTAAAATGAGCAAGG + Intergenic
1169514654 20:6302792-6302814 ATGAAAAATCAACATTAAGAAGG - Intergenic
1170096324 20:12649622-12649644 ATGAAGAAAGGAAAGGAGGAGGG + Intergenic
1170130385 20:13012743-13012765 CTGAAGAATCACAATCAGCATGG + Intronic
1170583590 20:17717019-17717041 AGAAAGAATGAAAATGAGGGTGG - Intronic
1173096058 20:40029619-40029641 AGGAAGGAACAAAAAGAGGATGG + Intergenic
1173137587 20:40453048-40453070 CTGAAGGATCAAGAGGAGGAGGG - Intergenic
1173564105 20:44027126-44027148 ATGAATAATTTAAATGAGGGTGG + Intronic
1173674511 20:44822128-44822150 TTCAAGAAACAAAACGAGGAGGG - Intergenic
1174725341 20:52855838-52855860 ATGAAGAAAAACAATGAGGAAGG - Intergenic
1174774635 20:53332415-53332437 AAGAAGAATGAAAAAGACGATGG + Intronic
1175020131 20:55837378-55837400 ATGAAGAAACAAAATTGGAATGG - Intergenic
1175342506 20:58242807-58242829 ATGGAGGATTAAAATGAGGGAGG - Intergenic
1176792054 21:13329154-13329176 ATGAAGGAACAAAATGAAGTCGG - Intergenic
1179214285 21:39352854-39352876 AAGAAGAATGAAAATGAGTGAGG + Intergenic
1179783488 21:43717247-43717269 ATGATGGATCAAAGTGTGGAAGG + Intergenic
1181536804 22:23550504-23550526 ATGAAGAATGAATGGGAGGATGG - Intergenic
1181998314 22:26900882-26900904 ATGAAGGAACAAGATGATGATGG + Intergenic
1182637411 22:31739514-31739536 ATGCAGGATAAAAATCAGGAAGG - Intronic
1183636608 22:39067403-39067425 ATGAAGAATTACAGTGAGGTAGG + Intronic
1184970232 22:48014495-48014517 TTTAAGAATCAAAAGGAGGCCGG - Intergenic
1185121039 22:48970276-48970298 ATCAAGGAACAAAAAGAGGATGG - Intergenic
949467540 3:4359436-4359458 ATGAAAAATCAAAATTAGTTGGG - Intronic
949593055 3:5513666-5513688 AGGAAGAATCAATATGAAAATGG + Intergenic
949639291 3:6016829-6016851 TTAAAGGATCAAAATGAAGATGG - Intergenic
949690831 3:6636996-6637018 ATGGAGAATCTAAATTAGGGTGG - Intergenic
949817598 3:8076340-8076362 ATCAAGAGCCAAAAGGAGGAAGG - Intergenic
949823264 3:8138312-8138334 ATAAAGAAACAAAAGGAGGCTGG + Intergenic
949916108 3:8965850-8965872 AGGAAGAAAAAAAATAAGGAAGG - Intergenic
950177861 3:10888390-10888412 AGGAAGAATCTGACTGAGGATGG + Intronic
950514361 3:13454559-13454581 AAGATGAATGAAAGTGAGGAAGG - Intergenic
950675998 3:14554814-14554836 CTGCACAATCAGAATGAGGATGG + Intergenic
951298086 3:20963836-20963858 GGGAAGAATCAAAGTGGGGAGGG - Intergenic
951307349 3:21081683-21081705 ATGAAGAATTAAGATCAGGCAGG + Intergenic
951703149 3:25516489-25516511 ATGAATAATCAAATTGAGACTGG + Intronic
951824999 3:26859056-26859078 AGGAAGAATCACTAGGAGGAAGG + Intergenic
954060032 3:48059578-48059600 ATAAAGGATCAAAATAAGTATGG - Intronic
954911594 3:54115203-54115225 CTCAAAAATCAAAATGAGGCCGG + Intergenic
954978307 3:54718616-54718638 TTGAAGAATCAAAATGATATTGG - Intronic
955252223 3:57295213-57295235 ATTCAGAATCAAAATATGGATGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
955963513 3:64364789-64364811 ATAAGGAATCAAAAAGAGCAAGG + Intronic
956399987 3:68867670-68867692 ACGAAAAGTCAAAATGTGGAAGG + Intronic
956864659 3:73357106-73357128 ATGAAGAAAGAAAAAGAGGGAGG - Intergenic
957192623 3:77029351-77029373 ATGTAGAAGAAAAATGATGAGGG + Intronic
957199001 3:77107926-77107948 AAGAAGAAAGAAAATGAGGCAGG - Intronic
957304169 3:78435037-78435059 AAGAAGAATCATAATGATGATGG + Intergenic
957334163 3:78805326-78805348 ATTAAGAAACAAAAGAAGGAGGG - Intronic
958624119 3:96602936-96602958 AGGAAGAATCAATATGAAAATGG - Intergenic
958646088 3:96876378-96876400 ATGAAGAGTCAAACTGATGATGG - Intronic
958682173 3:97344907-97344929 ATGAAGGAACAAAAGAAGGAAGG + Intronic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
958953578 3:100442521-100442543 AGGAAGACTCAAAGTGGGGAGGG + Intronic
958955655 3:100463553-100463575 ATGAAGAATCAAAAACAGTTAGG + Intergenic
960314060 3:116154707-116154729 ATGACTAAGCAAAATGAGTAGGG - Intronic
960537482 3:118829157-118829179 AAGAAGAAACAAAAAGAGGGAGG + Intergenic
960583833 3:119302864-119302886 ATGAAGAGTCATAATAACGATGG + Intronic
960824146 3:121765800-121765822 ATGAAAAACCAAAAGGAGCAGGG - Intergenic
961177213 3:124845497-124845519 GTGAAGAATGAGAATGTGGAAGG - Intronic
961624874 3:128254908-128254930 ATTAAGAATGAAAATCAGGATGG + Intronic
961751720 3:129099816-129099838 ATAAAGAGTTAATATGAGGAAGG + Intronic
963706895 3:148698716-148698738 TTGAATAATCAAACTGAGGAAGG + Intronic
964858650 3:161175068-161175090 ATAAAAAAACAAAATGAGGCTGG - Intronic
964892863 3:161557760-161557782 AGGAAGAATCAAAGGGAGTAGGG - Intergenic
964977590 3:162638795-162638817 ATGAAGAAACATAATGAAGTTGG - Intergenic
964981791 3:162691719-162691741 AAAAAGAATCAAAATTATGAAGG + Intergenic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966406518 3:179604322-179604344 AGGCAGCAACAAAATGAGGAAGG + Intronic
966565206 3:181372106-181372128 AAGAAAAAGCAAAATGAGAAGGG + Intergenic
967546119 3:190730731-190730753 ATCAGGAATAAAAATGAGAAGGG - Intergenic
968466777 4:755874-755896 CTGAAGAAGAAAAATGAGGAGGG - Intronic
968931776 4:3583879-3583901 ATGAAGAATAAAAAGCGGGAAGG - Intronic
970258317 4:14194075-14194097 AGGAAGAATCAAAATGTGTGTGG - Intergenic
970634004 4:17987172-17987194 ATGAAGTCTCAAAATGATGTGGG + Intronic
970996367 4:22271785-22271807 ATTAAGAAACAAAGTGGGGAGGG + Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971666882 4:29498629-29498651 ATCCAGTATCAAAATCAGGAGGG + Intergenic
971722853 4:30269056-30269078 CTAAAGAATCAAAATTAGAATGG - Intergenic
972820638 4:42697895-42697917 AGGAAGAATCAATATGAAAATGG - Intergenic
973656845 4:53056832-53056854 AGGAAGAGTAATAATGAGGAAGG + Intronic
973736984 4:53881514-53881536 AGGAAGAATCAATATGAAAATGG + Intronic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974070331 4:57117785-57117807 AACAAGAATCAAAAAGAAGAGGG - Intergenic
974431041 4:61796281-61796303 ACGAAGATTCAAAATGATTAAGG - Intronic
974546976 4:63324028-63324050 ATGATGAACTAAAATGAAGATGG + Intergenic
974766303 4:66350971-66350993 ATAAAGAATGAAAATTTGGATGG + Intergenic
975134532 4:70861754-70861776 ATAAAGAAACAAAATGAAGGAGG + Intergenic
975545901 4:75560314-75560336 ATGAAGAATGAAAATTTTGAGGG + Intronic
975938713 4:79614148-79614170 ATGTAGAATTAAGATAAGGATGG - Intergenic
976359496 4:84160945-84160967 AAGAAGAAGGAAGATGAGGAAGG - Intergenic
976366110 4:84234139-84234161 ATGGAGAATAAAAATGATGAAGG + Intergenic
976553646 4:86425122-86425144 AGAAAGAATCAACATGTGGAGGG + Intronic
977177199 4:93831998-93832020 ATGAAGCACCAAAAAGAGCAAGG + Intergenic
977187528 4:93958714-93958736 ATAATGAATCAAAATGAGAAAGG - Intergenic
977305121 4:95314427-95314449 ATGAAGAATCAAAGTGCATAAGG + Intronic
977473891 4:97478743-97478765 ATGACTAAAAAAAATGAGGAAGG + Intronic
977759088 4:100709332-100709354 ATGAATAATAAATTTGAGGATGG + Intronic
977831360 4:101597466-101597488 AGGAAGAAACAAACTGAGGATGG - Intronic
978167457 4:105625879-105625901 AAGAAGGATCAGCATGAGGAAGG - Intronic
978444273 4:108765639-108765661 ATAATGGATCAAAATAAGGATGG + Intergenic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
978900034 4:113937929-113937951 AGGAAGAATCAATATGAAAATGG + Intronic
979281463 4:118872827-118872849 ATGGAGACTCAAAAGGGGGAGGG - Intronic
979955770 4:126952156-126952178 TGGATGAATCAAAATGAGTATGG - Intergenic
980487168 4:133473733-133473755 ATGGAGAATGAACTTGAGGAGGG - Intergenic
980663993 4:135904448-135904470 GTGAAAAAACAAAAGGAGGAGGG + Intergenic
981173720 4:141655246-141655268 ATGAAGGTTCATAAAGAGGATGG + Intronic
981480531 4:145234187-145234209 ATGAGGATTTAACATGAGGAAGG - Intergenic
981806692 4:148724363-148724385 ATGAAGAATCAAAAACATGATGG - Intergenic
981910581 4:149976737-149976759 ATGAAGGAGCCAAATCAGGATGG + Intergenic
981978924 4:150768270-150768292 TAGAGGAATCAACATGAGGAAGG + Intronic
982419220 4:155174878-155174900 ATAATGAATAAAAATGAGTATGG - Intergenic
982922073 4:161288368-161288390 AAGAAAAATCAAAAAGAGGCCGG + Intergenic
982924243 4:161316043-161316065 ATGAAGAGGGAAAATTAGGATGG + Intergenic
983203160 4:164884205-164884227 AAGAAGAAAGAAAAAGAGGAAGG + Intronic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984005448 4:174300718-174300740 AAAAAGAATCAAAATGATGGGGG - Intronic
984351739 4:178603183-178603205 ATAAGGAATCAGAATGAAGATGG - Intergenic
984380182 4:178982892-178982914 ATGAAGAAAGAAGATAAGGATGG - Intergenic
984612354 4:181855949-181855971 AGGAAGGAACAAAAGGAGGAAGG + Intergenic
985227280 4:187775367-187775389 AGGAAGACTTAAAGTGAGGAAGG + Intergenic
986566759 5:9123416-9123438 AAGAAGAAGGAAAAGGAGGAGGG + Intronic
986956100 5:13151780-13151802 AGGAAGAATCAATATGAAAATGG - Intergenic
987568167 5:19620566-19620588 ATGAAGAAGCAGAATGAGAGAGG + Intronic
987635188 5:20530275-20530297 AGGAAGAATCAATATGAAAATGG + Intronic
988219964 5:28331999-28332021 ATGAAGAAGAAAAAAGAGTATGG - Intergenic
988269847 5:28999731-28999753 CTGAAGAGTTAAAATGAAGATGG + Intergenic
988650497 5:33143899-33143921 ATGAAGAAACAAGTTGAGAAAGG + Intergenic
989393075 5:40923084-40923106 ATTAAGAATCAAAATGTAAAGGG + Intronic
990103067 5:52217038-52217060 AGGAAGAATCAATATGAAAATGG - Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
990272969 5:54165569-54165591 AGTAAGAATAAAAATAAGGATGG - Intronic
992588708 5:78270854-78270876 CTACAGAATCAAAAGGAGGAGGG - Intronic
992696867 5:79297898-79297920 ATCAAAAATCAAACTGAGAAAGG - Intronic
992899836 5:81283051-81283073 ATGAAGAATAAAAAGAATGAAGG - Intergenic
993729671 5:91407336-91407358 ATAAAGTATCAAAGTGAGAAAGG - Intergenic
993858589 5:93105630-93105652 ATGAAGTATCAGAATGAAGGGGG - Intergenic
994230159 5:97302575-97302597 AGGAAGAATCAATATGAAAATGG - Intergenic
994437193 5:99752072-99752094 ATGAAGAAAGAAATTGAAGAGGG - Intergenic
996267246 5:121556333-121556355 AGGAAGAATCAATATGAAAATGG - Intergenic
996277825 5:121689043-121689065 ATGAAGAGCAAAAATGGGGAAGG + Intergenic
996942280 5:129022657-129022679 TTACAGAATAAAAATGAGGAGGG + Intronic
997040866 5:130252120-130252142 AAGGAGAAGAAAAATGAGGAAGG - Intergenic
997532061 5:134587559-134587581 ATAATGAATAAAAAAGAGGAGGG + Intergenic
997576430 5:134981090-134981112 AAGAAGAAACAAAAGAAGGAAGG - Intronic
997763360 5:136472518-136472540 AAGAAGAATCAAAAGGAGATGGG - Intergenic
998058520 5:139100189-139100211 ATGAAGCAACAAAATAAGTAAGG - Intronic
998425268 5:142021309-142021331 ATGGATAATCAAAATGTGGTAGG - Intergenic
998814531 5:145999481-145999503 ATGATTAATCTTAATGAGGAAGG - Intronic
998878820 5:146626946-146626968 ATCAAAAATGGAAATGAGGATGG + Intronic
999115265 5:149157433-149157455 ATAAAGAATCAGAAGGAGGAAGG - Intronic
999874013 5:155782319-155782341 AAGAAAAATAAAAATGAGGCCGG - Intergenic
1000456131 5:161451690-161451712 ATGAAGAATGATGGTGAGGAGGG + Intronic
1000633656 5:163619054-163619076 ATGAAGAAGAAAAAGGAAGAGGG - Intergenic
1000638468 5:163671760-163671782 ATCAAGAAAATAAATGAGGAAGG + Intergenic
1000738035 5:164930056-164930078 AGGAAGAATCAATATGAAAATGG - Intergenic
1001144880 5:169175141-169175163 AAGAAGGAACAAAATGAAGAAGG + Intronic
1001551579 5:172606313-172606335 ATCAGGAATCAAAATGAAGCTGG + Intergenic
1002652548 5:180711271-180711293 ATGAAGAATAATAATGAGAATGG + Intergenic
1002695874 5:181088109-181088131 CTGAAAAATAAAAATGAAGAGGG + Intergenic
1003681425 6:8261279-8261301 CTGATGAATGAAAATGACGATGG + Intergenic
1003959320 6:11194446-11194468 ATGAAGAGGCATACTGAGGAAGG - Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004090754 6:12498240-12498262 ATAAATAATAATAATGAGGAAGG + Intergenic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1004925084 6:20408652-20408674 ATGAAGAATCTAAGTGATGCAGG + Intronic
1004974827 6:20952907-20952929 ATGAAGAATCCTAATGAGAATGG - Intronic
1005056180 6:21730890-21730912 AAGAAGAATCTAAATGACCAAGG - Intergenic
1005258496 6:24031103-24031125 ATGGAGAATTTAAATGAGAATGG - Intergenic
1005442846 6:25889788-25889810 ATGAAACAAAAAAATGAGGAGGG + Intergenic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1007095971 6:39213443-39213465 ATACAAAATCAAGATGAGGAGGG - Intronic
1008124751 6:47655650-47655672 CTAAGGAAACAAAATGAGGAAGG + Intergenic
1008326394 6:50187350-50187372 AGGCAGAATGACAATGAGGATGG - Intergenic
1008425994 6:51357347-51357369 CTGAATAGTCAAAATGATGATGG - Intergenic
1008548945 6:52609139-52609161 AGGAAGAATCAATATGAAAATGG - Intergenic
1008686536 6:53931545-53931567 ATGAAGAATACAGATGAGGTTGG - Intronic
1008702280 6:54115484-54115506 ATGAAGAAACAAATTACGGAAGG + Intronic
1008826961 6:55707451-55707473 ATAAAGTATTAAAATCAGGATGG - Intergenic
1009435852 6:63617807-63617829 ATGAAGAGCAAAAATGAAGATGG - Intergenic
1010338553 6:74720215-74720237 ATCAACAACCAAAATGATGAGGG - Intergenic
1010568991 6:77455002-77455024 TTGGAGATTTAAAATGAGGAGGG + Intergenic
1010609073 6:77930343-77930365 ATGAACCTTTAAAATGAGGAGGG + Intergenic
1011120510 6:83946948-83946970 AGGAAGAATCAATATGAAAATGG + Intronic
1012141685 6:95633198-95633220 ATCAACAATCAAAATAAAGAAGG - Intergenic
1012330965 6:97986600-97986622 AGGAAGAACAAAAATGAGGGTGG + Intergenic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1012993859 6:105953483-105953505 AAGAGGAACCAAAATGAAGATGG - Intergenic
1014005564 6:116413904-116413926 ATGAAGTTTCAAAATAATGAGGG - Intronic
1014591706 6:123280529-123280551 AGGAAGATTCAAAATTATGAAGG - Intronic
1014758805 6:125331841-125331863 AAGAAGAAAGAAAAGGAGGAGGG - Intergenic
1015483941 6:133746765-133746787 ATGAAGACTCAGAATTGGGAGGG - Intergenic
1015502246 6:133946448-133946470 ATAAAAAATTAAAATGGGGAAGG + Intergenic
1016710142 6:147161693-147161715 AGGAAGAAAGAAAAGGAGGAGGG - Intergenic
1017075681 6:150615632-150615654 GAGAAGAATCAGACTGAGGAGGG + Intronic
1017832315 6:158141668-158141690 AGGAAGAATCAAAAAGAGCCAGG + Intronic
1018882887 6:167903141-167903163 ATAGAGAATGAAAATGAGAAAGG - Intronic
1018992120 6:168682112-168682134 ATCAAGAAACAAAAGGAGGGAGG + Intergenic
1020891461 7:13883024-13883046 ATGAAAAATCAAAATATGTATGG - Intergenic
1021061211 7:16115139-16115161 ATAAAGAACCAAACTGAAGAGGG + Intronic
1021704423 7:23352582-23352604 ATCAAGAATGAAAAAGAGGCTGG - Intronic
1022109253 7:27218229-27218251 AGGAAGAAACAAAGGGAGGATGG - Intergenic
1022131058 7:27405027-27405049 ATGGAGAACCAAAAATAGGAAGG + Intergenic
1023621769 7:42080656-42080678 ATGAAGAATGAAAAGCAGTATGG + Intronic
1023761882 7:43471795-43471817 ATGAATAAATAAAATGAGAAGGG + Intronic
1023915699 7:44587301-44587323 ATCAAGAATAAAAATAAGGCAGG + Intergenic
1026191884 7:68136359-68136381 AAGAAGAAGAAAAAGGAGGAGGG + Intergenic
1026284830 7:68954035-68954057 AGGAAGAAGAAAAATCAGGAGGG - Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1027663557 7:81016829-81016851 ATGAAAAATAAAAATGCGGCTGG - Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1027997929 7:85449909-85449931 AGGAAGAAAGAAAATGAAGAAGG + Intergenic
1028102728 7:86841293-86841315 ATGAACAATAAAGATGAAGAAGG + Intronic
1028384716 7:90242142-90242164 ATGAAGAATTTCACTGAGGAGGG + Intergenic
1030069864 7:105689271-105689293 GGGAAGAATCAAAGTGAGGAAGG + Intronic
1030394128 7:108964171-108964193 ATGAAAAATCGAAATGAAAAAGG + Intergenic
1030607812 7:111656896-111656918 AAGGAGAATGAAAATGAGCAGGG + Intergenic
1030952706 7:115811782-115811804 ATAAATAATCAAGATGGGGAGGG + Intergenic
1031438211 7:121759654-121759676 ATGAAGAATGAAAAAGAACAAGG + Intergenic
1031480481 7:122272562-122272584 AGGAAGAAAGAAAATGAGAAAGG - Intergenic
1031871813 7:127095961-127095983 AAGAAGATTCAAAATGAAAAAGG + Intronic
1031878501 7:127169097-127169119 ATGAGGAAGCTTAATGAGGAAGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1033293060 7:140104891-140104913 AGGAAGAATCAATATGAAAATGG - Intronic
1033469459 7:141631852-141631874 ATGAGAAATCCAAATGAGGCCGG - Intronic
1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG + Intergenic
1034134112 7:148749772-148749794 ATGATTAAGCCAAATGAGGAAGG + Intronic
1034775605 7:153823957-153823979 TTGAATAATCAAAATCAAGAGGG - Intergenic
1036036783 8:5028701-5028723 ATGAAGCAACCAAATGAGGTGGG - Intergenic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036653100 8:10658364-10658386 ATGAAGCATCAAAAAGGGAATGG + Intronic
1036836246 8:12071034-12071056 ATGTAGAATCAAACTGAAAAGGG - Intronic
1036858088 8:12317603-12317625 ATGTAGAATCAAACTGAAAAGGG - Intergenic
1038622225 8:29155149-29155171 ATGGAGAATCAAAAAAAGAAAGG + Intronic
1038761929 8:30392414-30392436 AGGAAGAATGAAACTGGGGAGGG + Intronic
1038934600 8:32234873-32234895 ATTAAGAATCAAACAGAGGTGGG - Intronic
1039598527 8:38812752-38812774 ATGAAGGGGAAAAATGAGGATGG - Intronic
1039832757 8:41229496-41229518 AGGAAGAATCAATATGAAAATGG + Intergenic
1040399681 8:47036296-47036318 ATGAAGAATGAGAGTGAGGTGGG + Intergenic
1040910640 8:52515095-52515117 ATAAAGAAGCAAGATTAGGAAGG + Intergenic
1041100130 8:54388108-54388130 ATTAAGAATCTTAGTGAGGAAGG - Intergenic
1041158472 8:55012210-55012232 ATGAATTATGAAAATGAAGAAGG - Intergenic
1041674483 8:60524245-60524267 CTGAAGAATTAAAATGAAGGAGG - Intronic
1042196471 8:66235173-66235195 AGGAAGAATCAATATGAAAATGG + Intergenic
1042978443 8:74498159-74498181 AAGAAGAATCAAAATGACTTAGG - Intergenic
1043196963 8:77307336-77307358 AAGGAGAATCAAAAAGAGAATGG + Intergenic
1043211056 8:77518505-77518527 TTGAAGAATGAAAATGAGAGAGG + Intergenic
1043764238 8:84109399-84109421 ATGAAAAAGAAAAATAAGGAAGG - Intergenic
1044152432 8:88798034-88798056 AAGAAGAAAGAAAAAGAGGAAGG - Intergenic
1044533356 8:93333004-93333026 AGGAAGAAACAAAATGAGGAAGG + Intergenic
1044822293 8:96162436-96162458 ATGAAAAAGCAAAAGGAAGAAGG - Intergenic
1044894285 8:96873247-96873269 ATGAATCATAAAAATTAGGAAGG + Intronic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1047080072 8:121450142-121450164 GTGAAGATTAAAAATGAGCAAGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048106880 8:131420686-131420708 ATGAAGGAAAAAAAAGAGGAAGG - Intergenic
1048155851 8:131950234-131950256 CTGAAGTAGCAAAATGAGAATGG + Intronic
1048259052 8:132930274-132930296 GTGAGGAATCAGCATGAGGATGG + Intronic
1048557466 8:135494576-135494598 CTCAAGAAACAAAAGGAGGAGGG - Intronic
1048870242 8:138791259-138791281 AGGAAGAATCAATAACAGGAAGG + Intronic
1049066550 8:140321010-140321032 ATAAAGTGTCAAAAAGAGGAGGG + Intronic
1049125714 8:140785784-140785806 ATGAAGAATTAAATTCAGAAAGG - Intronic
1050101459 9:2124279-2124301 ACTGAGAATCAAAATGTGGAAGG + Intronic
1050169589 9:2801496-2801518 ATGAAGATTGAGAATAAGGATGG + Intronic
1050202862 9:3165955-3165977 ATGAAGAATAAAAGGGAGAAAGG - Intergenic
1051311865 9:15783596-15783618 GTGAAGTATAAAAAAGAGGAAGG - Intronic
1051477332 9:17522448-17522470 GTGAAGAATCAAGGTCAGGATGG - Intergenic
1051493825 9:17696804-17696826 ATGAAAAATCGAAAAAAGGAAGG - Intronic
1051624478 9:19085722-19085744 ATGAGGAATCAAAATGAGTCTGG - Intronic
1051895592 9:21984476-21984498 ATCAAGAATGAAAAAGAGGGAGG - Intronic
1052492343 9:29185749-29185771 ATGAAGCAGCAAGATGTGGAAGG - Intergenic
1052527169 9:29632694-29632716 AAGATGAATGAAAATGAAGAGGG - Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1052574526 9:30275084-30275106 AGGAAGAATCAATATGAAAATGG - Intergenic
1052875511 9:33558929-33558951 ATCATAAATCAATATGAGGAAGG + Intronic
1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054637341 9:67506852-67506874 ATGAAGAAGCCAACTGAGGAAGG - Intergenic
1054721213 9:68605775-68605797 CTGAAAAATAAAAATGAGGTAGG + Intergenic
1055247208 9:74260977-74260999 ATGAAGAATAAATATCAGGCTGG + Intergenic
1055326111 9:75131806-75131828 ATGAAGCAGCAAAAAGAGGTAGG + Exonic
1055811603 9:80155323-80155345 ACAAAGAATGAAAGTGAGGAGGG - Intergenic
1055812627 9:80167102-80167124 ATTAAAAATCTTAATGAGGAAGG + Intergenic
1055894531 9:81159978-81160000 ATGAAGAATATATATGATGAGGG - Intergenic
1057344052 9:94231987-94232009 CTGAAGAAACAAAGTGAGGTGGG + Intergenic
1057679897 9:97169840-97169862 ATCATAAATCAATATGAGGAAGG - Intergenic
1057904852 9:98975531-98975553 ATGAAGAAACAAACAGAGCAGGG - Intronic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058649896 9:107165658-107165680 ATGAGCAATCAAAATAAAGAAGG + Intergenic
1059377856 9:113899845-113899867 ATGAATAAACAAAATGTGGTAGG - Intronic
1059669541 9:116479278-116479300 ATGAAGAAAGGAAATGAAGAGGG + Intronic
1060835245 9:126750938-126750960 GTGAACAACCAAATTGAGGAAGG + Intergenic
1060960507 9:127677427-127677449 AAGAGGGATCAAAATGAGAATGG + Intronic
1061442324 9:130614261-130614283 AAGAAGAATCAAGAAGATGAGGG - Intronic
1061777946 9:132978221-132978243 AGGAAGAAGGAAAATAAGGAAGG + Intronic
1186441285 X:9588897-9588919 TTTAAAAATCAAAATGAGGACGG - Intronic
1186554344 X:10541802-10541824 ATTAAGAAACAAATAGAGGAAGG + Intronic
1186796788 X:13054422-13054444 CTGAAGAATGAAACTGAGAAGGG - Intergenic
1186854613 X:13613893-13613915 TTGAAGAAAAAAAATGGGGATGG - Intronic
1187424103 X:19161570-19161592 ATTAAGAATCTTAATGAGGCTGG + Intergenic
1187636099 X:21230046-21230068 AGGAAGAATCAATATGAAAATGG - Intergenic
1187798056 X:23026199-23026221 AAGAAAAATCAAAATGATAAGGG - Intergenic
1188009024 X:25038713-25038735 ATGAAGAATGGAAAGAAGGATGG + Intergenic
1188596933 X:31912828-31912850 GTTCAGAATCAAAATGAGAAGGG - Intronic
1188661194 X:32760897-32760919 ATGAAGAAGAAATAAGAGGAAGG - Intronic
1188811099 X:34655866-34655888 TTGAAGAATCAAAATTAGAAAGG + Intronic
1189716803 X:43875433-43875455 TTGAATATTCAAAATCAGGAAGG + Intronic
1190056340 X:47183215-47183237 ATGGAGACTCAAAAGGTGGAGGG + Intronic
1190141187 X:47846438-47846460 ATGACCAATAAAAATGAGGGTGG - Intronic
1190287554 X:48971289-48971311 ATGAAGACTAAATAAGAGGAAGG + Exonic
1191031468 X:55978155-55978177 AGGACAAATCAAAATGAGAATGG - Intergenic
1191078091 X:56477813-56477835 ATGAAATTTCAGAATGAGGAGGG + Intergenic
1191642949 X:63447961-63447983 AGGAAGAATCAATATGAAAATGG - Intergenic
1191758437 X:64620940-64620962 ATTAAAAATCAACATGTGGAAGG - Intergenic
1192229321 X:69254272-69254294 ATGAATTATCACAATGAGGTAGG + Intergenic
1193492307 X:82165186-82165208 ATATAGAAGCAAAATGAGGGAGG + Intergenic
1193789297 X:85799321-85799343 ATAAAGAATCAAAATATTGATGG - Intergenic
1193959154 X:87902045-87902067 AGGACAACTCAAAATGAGGAGGG + Intergenic
1194142568 X:90223044-90223066 AGGAAGAAAGAAAAAGAGGACGG + Intergenic
1194549793 X:95282805-95282827 ATGAAGAATAATACAGAGGATGG - Intergenic
1194663610 X:96653585-96653607 GTGAAGATTCTATATGAGGAAGG + Intergenic
1194989294 X:100528206-100528228 ATTTAGAATCAAAATGGGGAAGG - Intergenic
1195318451 X:103701148-103701170 AGGAAGAAGGAAAAGGAGGAGGG - Intergenic
1195526248 X:105893385-105893407 GTGAAGAAGCAAAATATGGAGGG - Intronic
1195897327 X:109759845-109759867 AAGAAGAAACAATATGAGCAAGG + Intergenic
1195930128 X:110066096-110066118 AAGAAGAATGAAAATGAGAAAGG - Intronic
1196243328 X:113369153-113369175 ATGAAGAAAGAAACTGAGGTTGG + Intergenic
1196335846 X:114532918-114532940 ATGGAGAATCAAAATGTGTCAGG + Intergenic
1196760751 X:119198486-119198508 AAGAAGAATGAGAATGAGCAAGG + Intergenic
1197322610 X:125051236-125051258 AGGAAGAATCAATATGAAAATGG + Intergenic
1197375654 X:125678979-125679001 CTGAAGAATAAAAGTGATGAAGG + Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1197884036 X:131199393-131199415 ATGAAAAAACAAAAAGAGGGGGG - Intergenic
1198460861 X:136861758-136861780 AAGTAAAAACAAAATGAGGAGGG + Intronic
1199170166 X:144726198-144726220 ATGAAGAGGCAAAGTCAGGAGGG - Intergenic
1199269456 X:145865545-145865567 AAGAATAATTAAAATGATGAGGG + Intergenic
1200488322 Y:3792145-3792167 AGGAAGAAAGAAAAAGAGGACGG + Intergenic
1201738344 Y:17296130-17296152 ATGAATGATCAAACTCAGGAGGG - Intergenic
1201865630 Y:18650820-18650842 ATGTAGAATAAAAATAGGGAAGG - Intergenic