ID: 973998764

View in Genome Browser
Species Human (GRCh38)
Location 4:56488286-56488308
Sequence CACACTGACGAAAATGATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
973998764_973998765 11 Left 973998764 4:56488286-56488308 CCTATATCATTTTCGTCAGTGTG 0: 1
1: 0
2: 0
3: 9
4: 116
Right 973998765 4:56488320-56488342 TTAGAACAATTTCATAATTGTGG 0: 1
1: 0
2: 3
3: 24
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
973998764 Original CRISPR CACACTGACGAAAATGATAT AGG (reversed) Intronic
903360788 1:22775790-22775812 CACACTGAGGAAGATGCTCTGGG + Intronic
906655519 1:47545553-47545575 CACTCTGACCAAAATGAACTGGG - Intergenic
907795463 1:57711684-57711706 GAAACTGACTAAAAAGATATGGG - Intronic
908295388 1:62707630-62707652 CACACTGAAGGAAATGGCATGGG + Intergenic
909980819 1:82098573-82098595 CACACTGACTAAAAGGCTTTGGG - Intergenic
910432081 1:87168604-87168626 AACACTGATGAAAGTGAAATGGG - Exonic
913500883 1:119471685-119471707 TACACTGATGAGAATGAAATGGG + Intergenic
916503058 1:165403306-165403328 CACAGTGACTAAAGTGATTTTGG - Intronic
917649117 1:177059109-177059131 CACACTGATGAAAATGTTTAAGG - Intronic
920423973 1:205858546-205858568 CACACTGACCAAAAAGAAACTGG - Intergenic
922019869 1:221692834-221692856 GACACTGACGTAAGTGTTATAGG + Intergenic
923327995 1:232897942-232897964 TACACTGAAGAAAATGACTTAGG - Intergenic
924567862 1:245213012-245213034 CACACTGATTTAAAGGATATTGG - Intronic
1062846882 10:714480-714502 CAGACTGTTGGAAATGATATTGG - Intergenic
1063799661 10:9559922-9559944 CACACTGGTGAAACTGATTTTGG + Intergenic
1065394124 10:25216022-25216044 GACAATGAAGAAAATGTTATTGG - Intronic
1068263008 10:54607983-54608005 CACAATAACCAAAATGATGTAGG - Intronic
1068347689 10:55803999-55804021 CACACATAAGAAAATGATAAAGG + Intergenic
1068458452 10:57292555-57292577 GAAACTGAAGAAAATGTTATTGG - Intergenic
1071593234 10:86896317-86896339 CAAACTTAAGAAAATGTTATTGG - Intronic
1078865748 11:15295825-15295847 CACACAGAAGAAAATGGAATTGG + Intergenic
1081240086 11:40694781-40694803 CACACTGCACAAATTGATATAGG + Intronic
1081951188 11:47044586-47044608 GAAACAGAAGAAAATGATATAGG + Intronic
1082255338 11:50027606-50027628 CACACTGATGAAAAAGAAGTTGG - Intergenic
1087161511 11:94952610-94952632 AACACTGAAGAAAAAGATTTTGG + Intergenic
1087803147 11:102525970-102525992 AACACCGAAGAAAATGTTATGGG - Intronic
1089112269 11:116066128-116066150 CACACGTACGAAAATGATTTTGG - Intergenic
1093799350 12:23353424-23353446 CATAATGTCTAAAATGATATAGG + Intergenic
1095189832 12:39244788-39244810 CTCACTCACCAAAATGATAGAGG - Intergenic
1097658627 12:62401145-62401167 CACTGTGACGAAAATGATCTTGG - Intronic
1099532681 12:83804448-83804470 CTAAGTGACGAAAATGAAATTGG + Intergenic
1101525607 12:105526290-105526312 CAAAGTGAAGAAACTGATATTGG + Intergenic
1105204553 13:18209745-18209767 CAGAGAGAAGAAAATGATATAGG + Intergenic
1106087366 13:26555599-26555621 CACATTGAGGAAAATGGTAGGGG - Intergenic
1107050624 13:36044339-36044361 CACACTCATGAAAATGGTAAAGG + Intronic
1109550382 13:63889809-63889831 CACACTTACAAAAATAACATTGG + Intergenic
1109730755 13:66410320-66410342 CAAACTGAAGAACATGCTATAGG - Intronic
1109913406 13:68947129-68947151 CACACTAACAAAAATGATAGGGG + Intergenic
1110026678 13:70549139-70549161 CACAGTGACCTAGATGATATTGG - Intergenic
1110125870 13:71941643-71941665 AAAAGTGACAAAAATGATATTGG + Intergenic
1111897026 13:94154872-94154894 CTTACTGAACAAAATGATATTGG - Intronic
1119043184 14:71294062-71294084 CAAACTGTGGAAAATGATACAGG - Intergenic
1127169449 15:56285156-56285178 CACACTAACGAAAATTCTAGAGG - Intronic
1127655671 15:61053348-61053370 CACACTGACAAAAAGGACAAAGG + Intronic
1141746115 16:85927576-85927598 CACACAGACGTGAATGACATGGG + Intergenic
1149050093 17:52294112-52294134 AACAATAACGAAAAAGATATCGG + Intergenic
1150989185 17:70236010-70236032 CCCACTGACTCAAATGTTATGGG - Intergenic
1151280767 17:73072514-73072536 CACACTGTGGATAATGACATTGG + Intronic
1155894728 18:31310872-31310894 CACACTGACGTATGTGGTATAGG - Intergenic
1156274330 18:35568498-35568520 CAAAATGAGGAAATTGATATTGG - Intergenic
1158108735 18:53916380-53916402 CAGACAGAAGAAAATGATAAAGG - Intergenic
1158623578 18:59052587-59052609 CACATTGACGAAAAAAATACTGG + Intergenic
1158827559 18:61240475-61240497 CACAGTGAAGAAAATTTTATGGG + Intergenic
1166027027 19:40095935-40095957 CAAAATCAGGAAAATGATATAGG + Intergenic
1167218242 19:48179473-48179495 AACACTGTAGAAAATGAAATAGG - Intronic
925946880 2:8872672-8872694 CAAAGTGAATAAAATGATATTGG - Intronic
925954131 2:8944676-8944698 CACACACACGAAAATAATGTTGG + Intronic
940075744 2:149739891-149739913 CAAACTTATGAAAATTATATTGG - Intergenic
941348647 2:164403293-164403315 GACAATGAGGAAAATGCTATTGG + Intergenic
942463037 2:176182529-176182551 CACCCTGACTAAAATGATAAAGG + Intergenic
942559766 2:177208175-177208197 TACATTGACTAAAATTATATAGG - Intergenic
943492728 2:188576305-188576327 CACAGTGACCAAAGTTATATTGG - Intronic
944466186 2:200002189-200002211 CACACTGATGAAAAGGAGCTGGG - Intronic
946645492 2:221828865-221828887 CACTATGACGAGAATGGTATGGG - Intergenic
946874968 2:224119787-224119809 CACACTGTGAAAAATGATGTTGG - Intergenic
1173175574 20:40762524-40762546 CATACTGATGAAGATGAAATGGG - Intergenic
1176713424 21:10328343-10328365 CAGAGAGAAGAAAATGATATAGG - Intergenic
1177264382 21:18764633-18764655 CACCCTGACCATACTGATATGGG + Intergenic
1180829805 22:18898922-18898944 CAGAGAGAAGAAAATGATATAGG - Intergenic
1184227937 22:43141080-43141102 GACACTGCCAAAAATGATACTGG - Intronic
1203279896 22_KI270734v1_random:124195-124217 CAGAGAGAAGAAAATGATATAGG - Intergenic
949196481 3:1315635-1315657 CAAACTGAAGGAAATGGTATAGG - Intronic
950959966 3:17094898-17094920 CACATTGTGGAAGATGATATGGG + Intergenic
957640209 3:82843967-82843989 CACAATGAAAAAAATGATATAGG + Intergenic
965208192 3:165749246-165749268 AACACTGATGACAATCATATCGG - Intergenic
965468451 3:169061154-169061176 TACTCTGAAGAAAATGACATTGG + Intergenic
970490443 4:16568130-16568152 TACACAGACAAAAATAATATTGG - Intronic
972009521 4:34159096-34159118 CACACTGAAGAAAATGGCCTTGG + Intergenic
972690472 4:41392729-41392751 CACACTATTGAAAATGTTATAGG + Intronic
973998764 4:56488286-56488308 CACACTGACGAAAATGATATAGG - Intronic
974763780 4:66313074-66313096 CACACTGGGGAAAATGAAAATGG + Intergenic
974981477 4:68962870-68962892 AACACTGACTAAATAGATATAGG + Intergenic
975321778 4:73016686-73016708 CACAATGAAGAAAAAGATCTTGG + Intergenic
978268098 4:106851903-106851925 CCCACTGACAAAAAAGATCTTGG - Intergenic
979467448 4:121057147-121057169 CACTCTAAAGAAAATGATACAGG + Intronic
980556172 4:134408504-134408526 CACACTGAACACAATCATATTGG - Intergenic
981433084 4:144685114-144685136 GACACGCAGGAAAATGATATTGG - Intronic
984202385 4:176741353-176741375 AACATTGATGAAAATTATATTGG + Intronic
986196851 5:5544705-5544727 CACACTGAAGAAAATGCTCAAGG - Intergenic
986911693 5:12565592-12565614 CAAAATGTCGATAATGATATTGG - Intergenic
988212852 5:28228294-28228316 CACACAGAGGAAAACCATATGGG + Intergenic
989348691 5:40459038-40459060 GAAACTGAGGAAAAAGATATTGG + Intergenic
994991914 5:107007682-107007704 GGTACTGAAGAAAATGATATTGG + Intergenic
996724451 5:126661943-126661965 CACAATGAAGAAAATAATTTGGG + Intergenic
999551242 5:152689467-152689489 CACACTCAGGAAAATCTTATTGG + Intergenic
999694664 5:154178544-154178566 CACACTGAAGGAGAAGATATGGG - Intronic
1001876422 5:175205759-175205781 CACAGTGAAGAAAAGGATACAGG + Intergenic
1010226169 6:73491441-73491463 CAAACTGATAAAAATGATATAGG - Intronic
1010444316 6:75933897-75933919 CTCACCGATGAAAATGATGTCGG - Intronic
1011914535 6:92487808-92487830 CACCCTGAAGAAAATGGTACAGG - Intergenic
1012830004 6:104191966-104191988 CACAATGAAGAAAATGAACTAGG + Intergenic
1014370321 6:120598539-120598561 CACACTGAAGAAACTGAAAAGGG - Intergenic
1014894896 6:126890098-126890120 CACACTGATGAATAAAATATAGG - Intergenic
1015178173 6:130334083-130334105 CACACTTACCATAATAATATCGG + Intronic
1016345493 6:143109125-143109147 CACACTGAAGAAAAGAATCTAGG - Intronic
1018223604 6:161606502-161606524 AAGCCTGACTAAAATGATATTGG + Intronic
1020363589 7:7355910-7355932 AATACTGAGGAAAATGAAATAGG + Intergenic
1020560403 7:9724124-9724146 CACCCTGATGAAAATTATAGTGG - Intergenic
1022147594 7:27560876-27560898 ACCACTGTGGAAAATGATATTGG - Intronic
1027537435 7:79422090-79422112 CACACTAAAGAAAATGACTTTGG + Intronic
1031860256 7:126971417-126971439 AACACTGACGAACATAAAATAGG - Intronic
1035347755 7:158216471-158216493 CACTTTGAATAAAATGATATAGG + Intronic
1039013506 8:33121828-33121850 AACAGTGATGAAAATGATATTGG - Intergenic
1039952040 8:42180241-42180263 GACACTTACGACAATGACATTGG - Exonic
1043043566 8:75293080-75293102 CATACTGAGGAAAATGAGCTGGG - Intergenic
1044338333 8:91016404-91016426 AACACTGAAGAAAATGAAAGAGG + Intronic
1051443839 9:17118524-17118546 CCCACTAACAAAAATGAAATGGG - Intergenic
1052379619 9:27755989-27756011 CACACAGGCAAAAATTATATAGG - Intergenic
1055444863 9:76372366-76372388 CACAGCTACTAAAATGATATGGG - Intergenic
1058986650 9:110214125-110214147 CACACTTAAGAAAGTGATACAGG - Intergenic
1186428243 X:9482443-9482465 GACACTGACTAAAAAGATATGGG + Intronic
1188572238 X:31601825-31601847 CACATGGACAAAAATCATATCGG + Intronic
1193692631 X:84666181-84666203 CACACACACGAAAATGAAATTGG - Intergenic
1195238570 X:102927439-102927461 CACACTAATGACAAAGATATTGG + Intergenic
1197595298 X:128456818-128456840 AACACTGTCTAAAATGAAATGGG + Intergenic
1201434328 Y:13940302-13940324 CCCACTGACAGAAAAGATATAGG + Intergenic