ID: 974003947

View in Genome Browser
Species Human (GRCh38)
Location 4:56537172-56537194
Sequence CCTGAGAAGGAGAAACAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974003947_974003954 19 Left 974003947 4:56537172-56537194 CCTGACTGTTTCTCCTTCTCAGG 0: 1
1: 0
2: 4
3: 36
4: 288
Right 974003954 4:56537214-56537236 CTGAATTCTTGAATTCTTGCGGG 0: 1
1: 0
2: 1
3: 19
4: 195
974003947_974003953 18 Left 974003947 4:56537172-56537194 CCTGACTGTTTCTCCTTCTCAGG 0: 1
1: 0
2: 4
3: 36
4: 288
Right 974003953 4:56537213-56537235 TCTGAATTCTTGAATTCTTGCGG 0: 1
1: 0
2: 0
3: 28
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974003947 Original CRISPR CCTGAGAAGGAGAAACAGTC AGG (reversed) Intronic
901202839 1:7476366-7476388 CCAGAGAAGGAGACACAGAATGG + Intronic
901378870 1:8859532-8859554 CCTGAGAAGCAGAACCAATAAGG - Intergenic
902337048 1:15759564-15759586 GCTGAGAGGGAGAAGCAGCCCGG - Intronic
902434651 1:16390410-16390432 GCTGAGAAGGAGGAGCAGGCAGG - Intronic
903263128 1:22142124-22142146 CCAGTCAAGGAGAAACAGACAGG + Intronic
904313912 1:29647436-29647458 CCTGAGTGGGATAAACAGTGTGG - Intergenic
904874351 1:33642851-33642873 AGTGAGAAGCAGAAACAGTTTGG - Intronic
905003216 1:34689696-34689718 CCTGAGAAGGAGCAATTGTAGGG - Intergenic
907299025 1:53474635-53474657 CCTTAGCAGGAGAAACCTTCAGG - Intergenic
907826763 1:58025134-58025156 CCAGAGAAACAGAAACAGTAGGG - Intronic
909741802 1:79038096-79038118 CTGGAGAAGGAGAAAGAGACAGG - Intergenic
910188249 1:84568801-84568823 CCAGAGAAGGAGAAAGAGAGAGG - Intronic
912041104 1:105391831-105391853 CCTGAGAAAGAGAAAGAGCTGGG + Intergenic
912696131 1:111843484-111843506 CCAAAGAAGCAGAAACAGTCAGG - Intronic
914833637 1:151189771-151189793 CCTGAGACGGAGAAGCTCTCCGG - Intronic
915732283 1:158062199-158062221 CCTGACAAGGAAACTCAGTCAGG + Intronic
916181934 1:162092759-162092781 CCTGAGAAGAAGATGCAGTGTGG + Intronic
916409320 1:164529835-164529857 CCGGAGCAGGAGGAAAAGTCAGG + Intergenic
916704805 1:167338175-167338197 GCTGAGAAGGAGGAACAGGAGGG - Intronic
919511462 1:198470718-198470740 AGAGAGAAGGAGAAAGAGTCAGG - Intergenic
919781849 1:201226134-201226156 CCTGAGAGGGAGGAGCAGGCAGG + Intronic
919948540 1:202341158-202341180 CCTAAGGAGAAGAAACTGTCAGG - Intronic
920428403 1:205897709-205897731 CCTGAGAAACAGAAACAGCCAGG - Intergenic
920737902 1:208551792-208551814 ACTGAGAAAGAGAAACAGAAAGG + Intergenic
922078797 1:222274441-222274463 CCTGAGGAAGAGAATCAGTAGGG - Intergenic
1063285361 10:4681169-4681191 CCTGAAAAGAAGAAACACTCAGG - Intergenic
1064316398 10:14261762-14261784 CCTGAGAGGGAGAGACAGGAGGG + Intronic
1065309653 10:24402832-24402854 CCTCTGAAGGAGATCCAGTCTGG + Intronic
1065397494 10:25255440-25255462 CCTGAGCAGAGGACACAGTCAGG - Intronic
1065659483 10:27990952-27990974 CCAGAGAAGGAAAAAAAATCAGG + Intronic
1067760134 10:49038918-49038940 CCTGTGGAGGAGCAACAGCCAGG + Intronic
1067771072 10:49126125-49126147 CCTGAGAAAGACAAGCAGTGGGG - Intergenic
1072129793 10:92483337-92483359 CCTGTGATGGAGAAACAATTTGG + Exonic
1073009212 10:100346933-100346955 GCTGAGAAGGAGAAACAGAGGGG + Intergenic
1073190814 10:101649641-101649663 CCTGACAAGGAGAAAGAAGCTGG - Intronic
1073320003 10:102609966-102609988 CCTGAGAGTCAGAAACAGCCAGG + Intronic
1073687398 10:105770247-105770269 CCTGAGAATCTGAAACAGTTTGG + Intergenic
1074141359 10:110675963-110675985 TCTGAGAATGAGAAGCAGTGAGG + Intronic
1074306456 10:112283436-112283458 CCGGAGAGGATGAAACAGTCGGG + Intergenic
1075637376 10:124038529-124038551 CCTGAGCATGACAATCAGTCTGG + Exonic
1075647279 10:124104780-124104802 CCAGAGAAGTGGAAACTGTCAGG + Intergenic
1076143962 10:128102147-128102169 CTTGAGAAGGGGAAACTGTCTGG - Intronic
1076729596 10:132431784-132431806 CTGGAGAAGGAGAAATATTCTGG + Intergenic
1078636768 11:13058193-13058215 CCTGGAAAGCAGAAACAGTGTGG - Intergenic
1079369214 11:19836136-19836158 GTTGAGAAGGGGAAACATTCGGG - Intronic
1081207091 11:40289208-40289230 CCTGAGAATGAATAACAATCTGG - Intronic
1081606634 11:44531277-44531299 CCTGATAAGGAGAGCCAGCCTGG + Intergenic
1083372350 11:62192443-62192465 CCTGAGAAGGAGGAACATGCAGG - Intronic
1083378239 11:62243672-62243694 CATGAGAAGGAGGAACATGCAGG - Intronic
1083400674 11:62421286-62421308 CCTGAGAAGAAAACAGAGTCTGG + Intronic
1083479477 11:62934325-62934347 CCCCAGAAGGAAAAACAGCCGGG - Intergenic
1084078672 11:66803283-66803305 CTTGAGAATAAGAAACAGGCTGG + Intronic
1084098573 11:66929883-66929905 CCTAAGGAGGAGAAACAGGGAGG + Intronic
1085473056 11:76770288-76770310 CCTGATAAGGAGAAGAAATCTGG - Intergenic
1086174771 11:83878004-83878026 CCTGAGGAGGTGAAAGAGACAGG - Intronic
1088818213 11:113435533-113435555 CCTGAGAAGGGAACACAGTGGGG + Intronic
1089625500 11:119748445-119748467 CAAGAGAAAGAGAAACAGTCAGG + Intergenic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090897257 11:130989004-130989026 CCTGAGAAAAACAAACAATCGGG + Intergenic
1091509394 12:1106871-1106893 GCTAAGAAGGAGAAAGATTCTGG + Intronic
1093091252 12:14923195-14923217 CCTGAGAACCAGAAACACCCAGG - Intronic
1094404344 12:30098966-30098988 ATTGGGAAGGAGAAACAGTGTGG - Intergenic
1097911695 12:64976976-64976998 CCTGAAAAGGAGTAACCGTGGGG + Intergenic
1099993635 12:89753252-89753274 CCTGAGGAGGAGACCAAGTCAGG + Intergenic
1100774862 12:97962810-97962832 GCTGTGAAGTAGGAACAGTCTGG - Intergenic
1101316396 12:103632808-103632830 CCTGTGAAGGAGAAACTCACAGG + Intronic
1102513079 12:113428746-113428768 CCAGAGAAGGAGAGACAGAGAGG - Intronic
1103841599 12:123869700-123869722 CCTGAGAAGGAGGAAGGGGCTGG - Intronic
1103955802 12:124576201-124576223 GCTGAGAAGGAGAAAATGTGGGG - Intergenic
1104041627 12:125134620-125134642 CCTGAGAGGGAGAAAGAGCCGGG + Intronic
1105408308 13:20149894-20149916 GCTGAGAGGGAGCAACAGGCTGG + Intronic
1105647533 13:22337672-22337694 CCAGAGCAGGAGAAAGAGTGTGG - Intergenic
1105851843 13:24342042-24342064 CCAGAGAAGGAGCAACACTGAGG + Intergenic
1107654833 13:42581104-42581126 TCTGAGGAGGAGAAACAGTAAGG - Exonic
1108171622 13:47747958-47747980 CCTGACAAGGAGAAGCTGGCAGG - Intergenic
1108201599 13:48049745-48049767 CATGAAAATGAGAAAAAGTCTGG - Intergenic
1108446064 13:50510251-50510273 CATGAGAAGCAGAGACAGGCTGG - Intronic
1108677001 13:52745718-52745740 CTTGAGAAGGAGAGAGAGTCAGG + Intergenic
1111706319 13:91753503-91753525 CCTGAGCAGGAGAAACCCTGAGG - Intronic
1111806620 13:93046103-93046125 TCTGAGGAGGAGAAAGAATCAGG + Intergenic
1111881009 13:93957042-93957064 CCTGTGAAGGACAAAATGTCTGG + Intronic
1112394203 13:99013660-99013682 CCTGGGAAGTAGAAACAGCAAGG + Intronic
1113447189 13:110378507-110378529 TCTGAGATGGAGAAAGATTCTGG + Intronic
1113516348 13:110904269-110904291 ACTGAGAAGGAAAAACAGACTGG + Intronic
1113568619 13:111337681-111337703 CCTGAGGAGGGGAAACAGTGGGG - Intronic
1113767538 13:112890488-112890510 GCTGAGAAGCAGAGACAGACAGG - Intergenic
1114630774 14:24158120-24158142 CCTGAGGAGGAGAGACAGATGGG - Exonic
1115479031 14:33843844-33843866 ACTGAGTAGGAGACACAGACAGG - Intergenic
1116165583 14:41330300-41330322 CCTGGGAAGCACAAGCAGTCAGG - Intergenic
1116392032 14:44404358-44404380 AGTGAGAAGGAGATACATTCTGG - Intergenic
1116466090 14:45234521-45234543 CCTGAGCAAGAGGAACAATCAGG - Intronic
1116779286 14:49218412-49218434 ACTGAGAAGGAGAATAAGGCAGG - Intergenic
1117661564 14:58011201-58011223 ACTGAGAAGCAGAAATAGTAAGG + Intronic
1117667128 14:58068012-58068034 CCTGAAAAGAAGAATCATTCAGG - Intronic
1117925156 14:60771295-60771317 CATGAAAAGGGGAAACAATCAGG - Intronic
1118390676 14:65292944-65292966 ACTGAGAAGGGGTGACAGTCAGG - Intergenic
1118639096 14:67775859-67775881 CCTCAGAGGGAGAAACGATCAGG - Exonic
1118907879 14:70036028-70036050 ACTGAGAAGGAGAGAGAATCAGG - Intergenic
1119175027 14:72562569-72562591 ACTGTGAAGGAGAAAGAGTGAGG + Intronic
1120459569 14:84777571-84777593 CCTGAGCAGGAGGAAGAGTTGGG + Intergenic
1122034263 14:98936023-98936045 AGTGAGAAGGAGAAACATGCAGG + Intergenic
1122672865 14:103385495-103385517 CTAGAGAGGGAGAAGCAGTCGGG + Intronic
1202906019 14_GL000194v1_random:72915-72937 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1202886632 14_KI270722v1_random:113580-113602 GTTGAGAAGGAGAAATATTCAGG + Intergenic
1124687647 15:31796115-31796137 CCAGAGAAGCAGAACCAGTAAGG + Intronic
1124698664 15:31891299-31891321 CCTGAGAAAGAGAAACATCCAGG - Intergenic
1125812233 15:42551267-42551289 CCTGATAAGAAGAAAAAGGCTGG - Intronic
1126362422 15:47860112-47860134 CCTGAGAAGCAGAAACAGCGAGG - Intergenic
1126546349 15:49878616-49878638 CCTGGAAAGGGGAAAAAGTCTGG - Intronic
1127838170 15:62807458-62807480 CCTGAGTAGCAGAAACAGACTGG - Intronic
1127852323 15:62924649-62924671 CCTGAGAACGGGAAACAGCCTGG - Intergenic
1129073684 15:72973317-72973339 CCTGAGAAGGAGAAGCATGCTGG + Intergenic
1129196782 15:73973221-73973243 CCCGAGGAGGAGAAGCAGCCCGG - Intergenic
1129749884 15:78055110-78055132 CCTGAGAAGGCAAAATTGTCAGG + Intronic
1135165211 16:20133169-20133191 CCTTTGGAGAAGAAACAGTCAGG + Intergenic
1135246024 16:20857792-20857814 CCTCTGAAGGAGGAACTGTCAGG + Exonic
1135992255 16:27225203-27225225 CCTGAGAAGGAGAGGGAGTCTGG - Exonic
1137003129 16:35248763-35248785 CCTGAGGAGGGGAAAGATTCAGG + Intergenic
1137012726 16:35339035-35339057 CCTGAGGAGGGGAAAGATTCAGG + Intergenic
1137019392 16:35408573-35408595 CCTGAGGAAGAGAAAGATTCAGG + Intergenic
1138298712 16:55908882-55908904 CCTGAGAAGGGGAGCCACTCTGG - Intronic
1138386048 16:56636237-56636259 CCTGATAAGGTGAAACAGGAGGG + Intergenic
1139212921 16:65098401-65098423 CCAGAGAAGGAGGGTCAGTCTGG - Intronic
1139510743 16:67427189-67427211 GCTGAGAAGGAGAGGCAGTGAGG + Intergenic
1139914989 16:70422447-70422469 GCTGAGCAGGAGAAGCAGACAGG + Intronic
1140136205 16:72207686-72207708 CCAGAGAAAGAGAACCAGTAGGG + Intergenic
1140836603 16:78800177-78800199 ACTGAGAAGGAGAAAAAATATGG + Intronic
1141859524 16:86706924-86706946 CCCCAGATGGAGAGACAGTCTGG + Intergenic
1143563543 17:7708718-7708740 CCTGGGAAGGAGAACCTGCCAGG + Exonic
1144342149 17:14318725-14318747 GATGGGAAGGAGACACAGTCAGG - Intronic
1145413818 17:22695807-22695829 CCAGAGCAGGAGAAACCCTCTGG + Intergenic
1146774994 17:35606068-35606090 CCTCAGAAGGTAAAACAGTGGGG - Intronic
1147723008 17:42550205-42550227 CCTGGGAAGTGGAAACAGACAGG + Exonic
1147724219 17:42556432-42556454 CCTGGGAAGTGGAAACAGACAGG + Intergenic
1148138847 17:45313894-45313916 CCTCATAAGGAGAAACAGACAGG - Intronic
1148199556 17:45740792-45740814 CCAGAGAGGGAGAACCAATCAGG + Intergenic
1150352573 17:64457358-64457380 CATGAAAAGGATAAACAGACTGG - Intronic
1151505777 17:74526059-74526081 CCTTGGATGGAGAAACAGCCTGG + Exonic
1151505795 17:74526154-74526176 CCTTGGATGGAGAAACAGCCTGG + Intronic
1152121164 17:78419524-78419546 CCTGAGGAAGAGGAACAGACAGG - Exonic
1152685235 17:81690652-81690674 CCTGAGGAGGGGCAGCAGTCAGG - Exonic
1156127736 18:33927439-33927461 CCTGTTAAGGAGATACAGTGAGG - Intronic
1156392045 18:36659891-36659913 GCAGAGAAGGAGACACAGACAGG - Intronic
1156962117 18:43044801-43044823 CCATAGAAGGAAAAACACTCAGG - Intronic
1157583649 18:48787639-48787661 CCTGAGAAGGAAGAAGAGGCAGG + Intronic
1158571259 18:58598534-58598556 CATGAGGAGGAGAAATAGGCTGG + Intronic
1158832800 18:61298584-61298606 CCTGAGTAGCAGATACATTCAGG - Intergenic
1161708631 19:5834495-5834517 CCAGAGAAAGAGAAACCTTCAGG + Intronic
1162602337 19:11678298-11678320 CCTGAGAAGGAGAAGAACTGAGG - Intergenic
1163260803 19:16188753-16188775 CCTTAGAGGGAGAATCAGCCAGG + Intronic
1165009123 19:32830947-32830969 GCTGAACAGGAGAAACAGGCAGG + Intronic
1166862876 19:45819880-45819902 CCTGAGCAGGAGAAAAACTTGGG + Intronic
1166885049 19:45955332-45955354 CCTGAGAAGGAGAGACAGACAGG + Intronic
1167463381 19:49638103-49638125 CCTGAGCAGGAGAAGGAGACGGG - Intronic
1167798383 19:51725369-51725391 GATGAGGAGGAGAAACAGACAGG - Intergenic
1168063902 19:53908784-53908806 TCTGAGAAGGAGAGACAGCAGGG - Intergenic
924988385 2:289983-290005 CCTCAGGAGGAGAAAGTGTCCGG + Intergenic
926678832 2:15649042-15649064 CCCCAGAAGAAGAAACAGACAGG - Intergenic
926812990 2:16772896-16772918 CCTGAGGAGGTGACAGAGTCAGG - Intergenic
928909036 2:36400153-36400175 ACTGAGAAGGAGACAAAATCAGG + Intronic
929274086 2:40006505-40006527 CCTGATAAGGCTAAAGAGTCTGG - Intergenic
929838912 2:45435377-45435399 ACTGAGCTGGAGAAACAGACTGG + Intronic
934579037 2:95423685-95423707 ACTGAGAAAGAGAAACAGAGAGG - Intergenic
934600410 2:95653018-95653040 ACTGAGAAAGAGAAACAGAGAGG + Intergenic
936533772 2:113295081-113295103 ACTGAGAAAGAGAAACAGAAAGG + Intergenic
937114765 2:119397283-119397305 CCTGAGGAGGAGGAACAGGCTGG + Intergenic
938666710 2:133546269-133546291 CAGGAGAAAGAGAAAGAGTCAGG + Intronic
940239155 2:151544439-151544461 CCAGACACGGAGAATCAGTCTGG + Intronic
941412490 2:165177131-165177153 CCTCAGAAGGAAACAGAGTCTGG - Intronic
946796572 2:223360531-223360553 TCTCAGCAGGAGAGACAGTCTGG + Intergenic
946914737 2:224506371-224506393 CAGGAGAATGAGAAACAGTGAGG - Intronic
1170240990 20:14165843-14165865 CCTGAAAAGGCCAAACAGGCAGG - Intronic
1171891805 20:30724304-30724326 CCTGAGAAGGAGAGCCTGTCTGG + Intergenic
1173149039 20:40550279-40550301 CCTGAAAGCAAGAAACAGTCAGG - Intergenic
1173361054 20:42344696-42344718 TCAGAGAAGGACAAACAGTTGGG + Intronic
1174017920 20:47503453-47503475 TCTGAGAAGGGGAAACTGTAGGG - Intronic
1175617635 20:60414795-60414817 CCTAAGAAGCAGAAACTGTGTGG - Intergenic
1175639911 20:60620353-60620375 ACTGAGAAGGAGCATCAGTGAGG + Intergenic
1176625374 21:9087671-9087693 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1179026481 21:37683050-37683072 CCAGAGACTGAGAAACAGTATGG - Intronic
1180328866 22:11458068-11458090 GTTGAGAAGGAGAAATATTCAGG + Intergenic
1181894867 22:26098351-26098373 CCTGAGAAGGAGAAGATGCCTGG + Intergenic
1183478068 22:38046788-38046810 CCTGAGAAAGAGACAGAGACCGG + Intergenic
1184262179 22:43324737-43324759 CCAGAGAACGAGAAACAGGCAGG + Intronic
949135063 3:554567-554589 CCAGAGAAGCAGAACCAGTAGGG - Intergenic
949436247 3:4032707-4032729 ACTGAAAAGGAGAAAAAGACTGG - Intronic
950185275 3:10941099-10941121 CATGAGAAGGAGCCACAGTGGGG + Intergenic
950590856 3:13935009-13935031 CCTGAGAAGGAGGAACTGGCCGG + Intergenic
950662889 3:14477644-14477666 CCTGAGAAGGGCACACAGTCAGG - Intronic
950712056 3:14819831-14819853 CCTGAGAAGGAGGAGCTGGCCGG + Exonic
952293993 3:32045144-32045166 AGTGTGAATGAGAAACAGTCTGG + Intronic
953781143 3:45872022-45872044 ACTGAGACGGAGAAGCAGCCAGG + Intronic
953943976 3:47129587-47129609 CAAGAGAAGGAGATACAGGCTGG + Intronic
954727536 3:52626688-52626710 CGTGAGAAGGAGAAACGGTTAGG + Intronic
955299782 3:57766519-57766541 CCTGAGAAGAGGAAAGAGTCTGG - Intronic
955803800 3:62713222-62713244 CAGGAGAAGGAGAAATGGTCTGG - Intronic
956268758 3:67427675-67427697 CCTGAGAAGCACAAAGGGTCAGG + Intronic
957348355 3:78991201-78991223 CCTGAGATGGAAAAACAATTGGG + Intronic
957966731 3:87331480-87331502 CATGAGAAGAAGAAAAAATCTGG - Intergenic
959243449 3:103830291-103830313 CCTCAGAAATAGAAACAGTCTGG + Intergenic
959404595 3:105944769-105944791 CCTGAAAAGGAAAAACACTGAGG - Intergenic
960619133 3:119622415-119622437 TCTGAGAAGGAGAGACAGACAGG + Intronic
961723899 3:128913295-128913317 CCTGAGAAGGATAAAAACTAAGG - Intronic
962128437 3:132647538-132647560 CCTTAGAAGCATAAACAGACAGG + Intronic
966118801 3:176498777-176498799 CATGTGAAGGAGGAACTGTCAGG + Intergenic
967101643 3:186220921-186220943 CCTTAGGAGGAGATACTGTCAGG - Intronic
967570795 3:191026216-191026238 GCTTGGAAGGAGAAACAGCCAGG - Intergenic
967576826 3:191104482-191104504 CCAGAGTAGGAGGAAGAGTCAGG + Intergenic
968356119 3:198108942-198108964 CCTGAGGAGGAGAAAGACGCGGG - Intergenic
973336814 4:48964969-48964991 CCTGCTAAGGAGAAACTGACCGG - Intergenic
973633868 4:52844052-52844074 ACTGAGAGGATGAAACAGTCAGG + Intergenic
974003947 4:56537172-56537194 CCTGAGAAGGAGAAACAGTCAGG - Intronic
974754812 4:66189392-66189414 CGTGAGAAGGAGACACAGTTGGG - Intergenic
976691046 4:87867523-87867545 TCTGAGAAGAAGATACAGTTGGG - Intergenic
978976214 4:114877650-114877672 ACTTAGAAGGAGAAATAGGCCGG + Intronic
980607583 4:135112189-135112211 CCCGGGAAGCACAAACAGTCAGG - Intergenic
981141637 4:141276219-141276241 CCTGAGAAGAGGAAACAGCCTGG - Intergenic
983901410 4:173138917-173138939 GTTGAGAAAGAGAGACAGTCTGG + Intergenic
986110271 5:4709513-4709535 CCTGAGAAGGACAAGGGGTCAGG + Intergenic
986331247 5:6717438-6717460 CCAGAAAAGGACAAACAGTGAGG - Intronic
990352803 5:54935573-54935595 CCTGAGAAGGAGAAAAAGTGAGG + Intergenic
990979304 5:61587430-61587452 CCTGATAAGATGAAACAGACAGG - Intergenic
990998299 5:61755891-61755913 CATGAGATGGTGAAACACTCTGG + Intergenic
991223504 5:64242969-64242991 CCTGAGAAGCACAAAGGGTCAGG + Intronic
991236627 5:64406844-64406866 CCTGGGAAGCAGAAAGGGTCAGG + Intergenic
991416493 5:66397880-66397902 CATGAGAAGGAGAAACGGGAGGG + Intergenic
991940013 5:71841594-71841616 CCTGAGAAAGAGAAACCGATGGG + Intergenic
993347643 5:86805072-86805094 TCTGAGAGAGAGAAACAGTTTGG + Intergenic
993396357 5:87394484-87394506 CCTAAGAAGGAAAAAAAGTGTGG + Exonic
993445117 5:88002330-88002352 TCTAAGAAGGTGAAACAATCTGG - Intergenic
993701367 5:91122941-91122963 CAGGAGTAGGAGAAACAGGCAGG - Intronic
993722146 5:91332145-91332167 CTTGTGAATGAGAAACAGTGAGG - Intergenic
994167319 5:96621531-96621553 TGTGTGAAGGAGAAACTGTCAGG + Intronic
995396418 5:111691779-111691801 CATGAGCAGGGGAAACATTCAGG - Intronic
996000091 5:118350805-118350827 CCTGAGAGGGAGAAACAATGTGG - Intergenic
996051732 5:118942379-118942401 GCTGAGAAGGAAAAACTGTATGG + Intronic
996746812 5:126853124-126853146 CTTGAGGAGGAAAAACAGTAAGG - Intergenic
998380781 5:141723864-141723886 CCAGAGCAGGAGCAACAGTTGGG + Intergenic
998660970 5:144237132-144237154 TCAGAGTAGGAGAAACATTCTGG - Intronic
998933583 5:147208997-147209019 CCTTAGAAGCAAAAACAGGCAGG + Intergenic
999251079 5:150182746-150182768 CCTGAGAAGCAGAAGGAGCCGGG - Exonic
1000163756 5:158626999-158627021 CCTGAGATGGAGAAATAGGTTGG - Intergenic
1000925162 5:167185142-167185164 CCAGAGAAACAGAAACAGTAGGG - Intergenic
1001793846 5:174485029-174485051 TCTGAGAAAGAGCAAGAGTCAGG - Intergenic
1002391862 5:178920097-178920119 CCAGAGAAGGAGAAAATGTTTGG - Intronic
1003109611 6:3242528-3242550 CATAAGAAGGAGAAAGGGTCAGG - Intronic
1003140112 6:3464194-3464216 CCAGAGCAGGAGCAAGAGTCGGG - Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1010371437 6:75113917-75113939 CCTTAGAAGGAGAAAAATTTAGG + Intronic
1010892105 6:81325828-81325850 CCTGAGTAGGGGAAACTCTCAGG - Intergenic
1012647576 6:101706570-101706592 CCTGTGAAAGATAAACAGGCAGG + Intronic
1013366380 6:109441012-109441034 CCTGCGAAGAAGGAACGGTCTGG + Exonic
1014196257 6:118563010-118563032 ACAGAGGAGGAAAAACAGTCTGG - Intronic
1016647462 6:146426389-146426411 CCTGGCAATGAGAAACAGCCAGG + Intronic
1017278258 6:152595071-152595093 CCTGAAAAGGAGCAGCAGTATGG - Intronic
1017768796 6:157628800-157628822 CCTTAGCAGGAGAAAAAGTGAGG - Intronic
1018021733 6:159767573-159767595 CCTGAAAAGGTCAAAAAGTCTGG - Intronic
1018446300 6:163862120-163862142 CCATAGAAGGAGCAACACTCTGG + Intergenic
1019144319 6:169967095-169967117 CCTGAGAAGGAGAGACTCGCAGG + Intergenic
1019161927 6:170074704-170074726 CCTGAGAAGGAGGGACAGCCTGG + Intergenic
1019353659 7:567921-567943 CCTGGGAAGATGAAACATTCTGG + Intronic
1019703792 7:2487979-2488001 CCTCACCTGGAGAAACAGTCTGG + Intergenic
1020698448 7:11446324-11446346 CCTGTGGAAGAGAAACAATCAGG + Exonic
1021665307 7:22971381-22971403 GCTGAAAAGGGGAAACAGGCCGG + Intronic
1021978728 7:26033684-26033706 ACAGAGAAGGAGAAACAGCTGGG - Intergenic
1023401785 7:39796520-39796542 CCTGAAGAGGAGAAACTGACTGG - Intergenic
1023914625 7:44579652-44579674 AGTGAGCAGGAGAAACAGTCTGG + Intronic
1024075766 7:45817165-45817187 CCTGAAGAGGAGAAACTGACTGG - Intergenic
1024246175 7:47472034-47472056 CCTGAGAAGGTGGAAGAGGCAGG - Intronic
1024647832 7:51384142-51384164 CCTGAAGAGGAGAAACTGACTGG + Intergenic
1025051673 7:55738629-55738651 CCTGAAGAGGAGAAACTGACTGG + Intergenic
1025128635 7:56364296-56364318 CCTGAAGAGGAGAAACTGACTGG + Intergenic
1026329335 7:69338140-69338162 CCTGAGAGGGGGAGACTGTCAGG - Intergenic
1026432631 7:70362353-70362375 CCTGACAGGGAAGAACAGTCTGG - Intronic
1026568637 7:71510641-71510663 CCTGGTAAGGAGACACTGTCAGG - Intronic
1026893475 7:73996744-73996766 TCTGAAAAGGAGAAACACTTGGG + Intergenic
1027961556 7:84952448-84952470 GCTCAGAAGGAGAAACCGCCAGG + Intergenic
1028150936 7:87370706-87370728 CCTGGGAAGGAGTGAAAGTCTGG - Intronic
1028337444 7:89674612-89674634 CCTTTGAAGGAGAAGCATTCTGG - Intergenic
1029016654 7:97321732-97321754 CCTGAATTGGAGAAACAGACTGG + Intergenic
1029465312 7:100721194-100721216 CCTGTGAAGGGGACACAGTTTGG + Intronic
1031603742 7:123745397-123745419 ACTAAGAAGGAGATACAGTTGGG - Intronic
1032369949 7:131338897-131338919 GCTGAGAAGGAGAAAGAGAAGGG - Intronic
1032530061 7:132612693-132612715 GCTGAGAGGGAGAAAGAGTCAGG - Intronic
1035562486 8:616633-616655 ACAGAGAAGGAGAGACAGACGGG + Intronic
1037110316 8:15157900-15157922 CCTGAGAAGGAGGAACAACAAGG - Intronic
1038037232 8:23696677-23696699 ACTGAGGAGGAGAAACAGTCAGG + Intergenic
1040660701 8:49571982-49572004 CCATAGTAGGAGAAACAATCAGG - Intergenic
1041642400 8:60217443-60217465 CTTGAGAAGTGGAAAAAGTCAGG - Intronic
1042462521 8:69087004-69087026 CCTGAGAAGGTGAAAAAGAATGG - Intergenic
1045489319 8:102656575-102656597 CCAGAGAAGGATAAAAACTCGGG - Intergenic
1046530600 8:115440283-115440305 CCTGAGAAGTAGAAAATGTAAGG + Intronic
1047964277 8:130034171-130034193 CATGAAAAGGAAAAACAGGCCGG + Intergenic
1048375320 8:133818032-133818054 TCTGAGATGGAGAAAGAGTTGGG - Intergenic
1049614236 8:143569230-143569252 CATGAGAGGGAGAAACAGGAGGG + Intronic
1051646524 9:19274237-19274259 CCTGAGGAGGAGAAATAATGAGG + Intronic
1051942909 9:22530318-22530340 CCTGAGATGGAGTCACAGTGTGG - Intergenic
1053656589 9:40222946-40222968 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1053906944 9:42852168-42852190 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054357008 9:64071393-64071415 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054368694 9:64369168-64369190 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1054528025 9:66153339-66153361 CCTGAGAAGGAGGGCCTGTCTGG + Intergenic
1054868123 9:70024101-70024123 CCTGAGAATCAGAAACACTGAGG + Intergenic
1055920872 9:81459642-81459664 CATGAGAAGAAGAAACAGTGTGG - Intergenic
1056276977 9:85002964-85002986 GCTGAGTTGGAGAAACAGTTGGG + Intronic
1059044960 9:110856363-110856385 CCTGTGAAGGAGTAACAGTCAGG - Intergenic
1059490492 9:114662473-114662495 CCAGAGACAGAGAAACAGTGGGG + Intergenic
1059554614 9:115266877-115266899 CCTGAGAAAAACAAACACTCTGG - Intronic
1060435932 9:123593171-123593193 CCTGAGGAGGAGCAGGAGTCAGG + Intronic
1060890438 9:127184589-127184611 CCTGGGCAGGAGAAACACTGAGG + Intronic
1062355713 9:136161067-136161089 CCTGACATGGGGACACAGTCTGG + Intergenic
1203748548 Un_GL000218v1:58132-58154 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1203561172 Un_KI270744v1:59888-59910 CCTGAGAAGGAGGGCCTGTCTGG + Intergenic
1186565632 X:10659227-10659249 CCTGAGAAGCAGGAACATTTAGG + Intronic
1186791172 X:13000508-13000530 CCTTAGAAGGATATACAGGCAGG - Intergenic
1187043896 X:15626227-15626249 CCTGAGCAGAAGAACCAGTTAGG - Intergenic
1187840685 X:23484312-23484334 CCAGAGAAAGAGAACCAGTGGGG + Intergenic
1188263963 X:28047158-28047180 CCAGAGAAGCAGAACCAGTAGGG - Intergenic
1190112993 X:47607036-47607058 CCTGGGAAGGAGAAAAAAACTGG + Exonic
1190482002 X:50886653-50886675 CCTAAGAGGGACAAACAGGCAGG - Intergenic
1196270199 X:113700550-113700572 CGTGAGTAGGAAAGACAGTCTGG - Intergenic
1196581252 X:117381719-117381741 CCTGAGAACCAGAAACACTGAGG + Intergenic
1197902490 X:131389167-131389189 CATGAGAAAGAGAAGTAGTCAGG + Intronic
1198547816 X:137711701-137711723 TCTGAGATGGAGAAAAATTCTGG + Intergenic
1199712536 X:150480331-150480353 CCTAAGGAGTTGAAACAGTCTGG + Intronic
1200234500 X:154461765-154461787 CCTGGGAGGGAGAAACAGGTGGG - Intronic
1200917759 Y:8586251-8586273 CCTGGGAGGGAGAAACAGTGAGG - Intergenic
1201161892 Y:11173102-11173124 CCTGAGAAGGAGGGCCTGTCTGG - Intergenic
1202054809 Y:20818659-20818681 CCTGGGAAGCACAAAGAGTCAGG + Intergenic