ID: 974009568

View in Genome Browser
Species Human (GRCh38)
Location 4:56594549-56594571
Sequence CTCTCCTTTCTGGTTTAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 2, 1: 0, 2: 4, 3: 20, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974009568_974009575 18 Left 974009568 4:56594549-56594571 CCTACTTAAACCAGAAAGGAGAG 0: 2
1: 0
2: 4
3: 20
4: 193
Right 974009575 4:56594590-56594612 CTCATTCTGAAATCAACACATGG 0: 1
1: 0
2: 2
3: 14
4: 251
974009568_974009573 -10 Left 974009568 4:56594549-56594571 CCTACTTAAACCAGAAAGGAGAG 0: 2
1: 0
2: 4
3: 20
4: 193
Right 974009573 4:56594562-56594584 GAAAGGAGAGGGGCACAGAACGG 0: 2
1: 1
2: 10
3: 121
4: 1100
974009568_974009576 19 Left 974009568 4:56594549-56594571 CCTACTTAAACCAGAAAGGAGAG 0: 2
1: 0
2: 4
3: 20
4: 193
Right 974009576 4:56594591-56594613 TCATTCTGAAATCAACACATGGG 0: 1
1: 1
2: 2
3: 17
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974009568 Original CRISPR CTCTCCTTTCTGGTTTAAGT AGG (reversed) Intronic
903728287 1:25469329-25469351 CATTCCTTTCTGGTTTAAGTTGG + Intronic
909255697 1:73418097-73418119 CTCTCTTTTCTGTTTTACTTTGG - Intergenic
910424647 1:87108402-87108424 TTCTCCTTTATGATTTGAGTTGG + Exonic
911632249 1:100196393-100196415 TTCTCCTTTCTGGTTAAATCGGG + Exonic
913670129 1:121089709-121089731 AACTCCTTACAGGTTTAAGTGGG - Intronic
914021893 1:143877122-143877144 AACTCCTTACAGGTTTAAGTGGG - Intergenic
914660377 1:149785061-149785083 AACTCCTTACAGGTTTAAGTGGG - Intronic
915142187 1:153774784-153774806 CTCTCCATCCTGGTTTTAATTGG - Intronic
918611399 1:186496513-186496535 CTCTCCTTTCTCTTATAAGCAGG - Intergenic
918807511 1:189068241-189068263 TTCTGGTTTCTGGTCTAAGTTGG + Intergenic
921962057 1:221046422-221046444 TTCTCCTTTCTCTTTTAAATAGG - Intergenic
922670932 1:227508305-227508327 CTGCCCTTTCTGGTTAAAGGGGG + Intergenic
923831727 1:237565759-237565781 CTCTCCTCTGTGGTTTCAGAAGG + Intronic
924075667 1:240333188-240333210 ACCTCCTTTCTGGTTTATTTAGG - Intronic
1063495562 10:6504378-6504400 CTCTTCATTCTGGTTTCAGCAGG + Intronic
1066348954 10:34618895-34618917 GTCTCCTTTCTGGTTTCACTTGG + Intronic
1070014219 10:72509416-72509438 CTTTCCTTTGTGGTTTATGATGG - Intronic
1071375036 10:84993769-84993791 CTCTCCTTTCTGGCATTAGCCGG + Intergenic
1071591390 10:86876994-86877016 TTTTCCTGTATGGTTTAAGTAGG + Intronic
1072966952 10:99982023-99982045 TTCTCCATTCTGCTTTAAGTTGG + Intronic
1075283605 10:121163106-121163128 CTGGCCTTTCTAGTTTAAGAGGG + Intergenic
1076128793 10:127996800-127996822 CTCTCATTTCTTTTTGAAGTGGG + Intronic
1076215773 10:128692561-128692583 CTGTCCTTTCTGATTTGATTAGG - Intergenic
1076259253 10:129052678-129052700 CTCTGCTTTTTGGTAGAAGTGGG - Intergenic
1077312345 11:1894893-1894915 CTCTCATTTCTTGTTGCAGTTGG + Intergenic
1078401329 11:11029966-11029988 CTCTCCAGTCTGCTTTAATTTGG + Intergenic
1083403205 11:62439036-62439058 CTCTCCTTCCTGGTTCACTTTGG - Intronic
1083873330 11:65505799-65505821 CTCCACTTACTGGTTTAAGTTGG - Intergenic
1086466245 11:87056478-87056500 ATTTCCTTTCTGGTTCAGGTAGG + Intronic
1086598540 11:88604621-88604643 CTCTCCTTTGTGGTTAATCTAGG - Intronic
1086972766 11:93101564-93101586 GTCTCCTTTCTGGTCTCAGAAGG - Intergenic
1087346257 11:96974960-96974982 GTCTCCTTTCTGCATTAAATTGG + Intergenic
1087525284 11:99302153-99302175 CTCTTCTTTTTCTTTTAAGTTGG - Intronic
1088292732 11:108258688-108258710 TCCTCCTTTTTGGTGTAAGTGGG + Intronic
1091678265 12:2507313-2507335 CTCCCCTTTCTGGTTTAAGGAGG + Intronic
1092878703 12:12871133-12871155 CTCTTCCTTCTGGTTCAAGTTGG - Intergenic
1095630384 12:44369764-44369786 CTAGACTTTCTGGTTCAAGTAGG - Intronic
1096491115 12:52013606-52013628 CTCCCCTTTCTGGCTAAGGTAGG + Intronic
1097964268 12:65562339-65562361 CTCTCCTTTTTAGATTATGTAGG - Intergenic
1098501833 12:71202051-71202073 CTCTACTCTTTGGCTTAAGTTGG - Intronic
1098546054 12:71712115-71712137 CTCTCCATTTTTTTTTAAGTGGG - Intergenic
1100286412 12:93171217-93171239 CTCTTCCCTCTTGTTTAAGTGGG + Intergenic
1100511530 12:95279552-95279574 TTCTGAGTTCTGGTTTAAGTGGG + Intronic
1104380708 12:128305275-128305297 CAATCCTTTCTGTTTAAAGTCGG - Intronic
1105839142 13:24238456-24238478 CTCTCCTTGATGTTTTAGGTGGG + Intronic
1106447102 13:29845388-29845410 TTCTTATTTCAGGTTTAAGTTGG - Intronic
1107401627 13:40074926-40074948 CTCTCTTTTCTGGGTTATGAAGG - Intergenic
1107881250 13:44833850-44833872 CCCTCCATCCTGGTTTGAGTGGG - Intergenic
1107907353 13:45073566-45073588 ATATCCTTTTTGTTTTAAGTGGG - Intergenic
1108320086 13:49281316-49281338 CTCTCCTTTCTGGCTTAGAGAGG + Intronic
1112756763 13:102643896-102643918 CGCTCCTTTGTGTTTTCAGTTGG + Intronic
1112821490 13:103342151-103342173 CTTTCTTTTCTGGTTTTATTTGG + Intergenic
1113647334 13:112007970-112007992 CTCTCCTGCCTGGTTTAATCTGG + Intergenic
1114976623 14:28108831-28108853 CTCTCCTTTCTCGTTTCTTTTGG + Intergenic
1115821421 14:37216116-37216138 AGCTCCTTTCTGGTTTCTGTTGG - Intronic
1124795216 15:32771633-32771655 CTCTCCTTTCTAGTTCAGGGAGG + Exonic
1125130896 15:36283019-36283041 CTCTCTTTTGTGGTTTTTGTTGG - Intergenic
1125430554 15:39589221-39589243 CTCTCCATTGTGGTTGAAGCAGG - Exonic
1128988303 15:72237207-72237229 CTGTCCTTCCTGGGATAAGTGGG - Intergenic
1131509753 15:93043599-93043621 CTCTCCCTGCTGGTTTTAGTTGG - Intronic
1131816917 15:96231566-96231588 TTCTCCTTTTTGGTTTTAGTTGG - Intergenic
1134320992 16:13162568-13162590 CTCTCCTCTCTGGTAGAACTGGG + Intronic
1137583430 16:49649035-49649057 CTGTCCTTTTTGGTTTAAGCTGG - Intronic
1138405041 16:56785406-56785428 CTCTCCTTTCTGGTACTTGTAGG + Intronic
1138483994 16:57324081-57324103 TTTTCCTTTATGGTTTTAGTGGG - Intergenic
1140722002 16:77780500-77780522 GTCCCCTTTCTGGTTTCTGTTGG + Intergenic
1144119269 17:12134659-12134681 CTCTACTCTCTTGTTTAATTTGG - Intronic
1145012851 17:19379364-19379386 CTCTCCATTCTGGTCTAACTGGG - Intronic
1149355569 17:55835726-55835748 CTCTCCTGTCTGGTACAAGGTGG + Intronic
1149540804 17:57466641-57466663 CTCCCTTCTCTGGTTTAAGTTGG + Intronic
1149632236 17:58135936-58135958 CTCTTCTTGCTGGCGTAAGTGGG - Intergenic
1151378481 17:73708297-73708319 CTTTGCCTTCTGGTTTCAGTTGG + Intergenic
1151759760 17:76093935-76093957 CTTTCCTTTCTGGATCAACTGGG + Intronic
1153244680 18:3062061-3062083 CTCTCGTTTCTGGTTTTAGAAGG - Intergenic
1155576161 18:27249304-27249326 TTTTCCTTTCTTGCTTAAGTTGG + Intergenic
1159840615 18:73394488-73394510 TTCTCCTTTCTCATTTCAGTAGG + Intergenic
1160668745 19:345783-345805 CTCTTCTTCCTGGTCTCAGTAGG - Intergenic
1164153391 19:22573351-22573373 CTGTCCATTCTGTTTTAAGTTGG - Intergenic
1164220461 19:23188546-23188568 CTGTCCATTCTGTTTTAAGTTGG + Intergenic
1164227609 19:23259687-23259709 CTCTCCTATCTGGACTCAGTTGG - Intergenic
1166930581 19:46299024-46299046 CTCTCCTTCCTGGTTGGAGGGGG + Intronic
925015561 2:521887-521909 CTGTCTTTTATGCTTTAAGTTGG + Intergenic
925607814 2:5676618-5676640 TTCTCTTTTCTGGTTTAATGTGG + Intergenic
926469039 2:13229953-13229975 CTCTATTCGCTGGTTTAAGTTGG - Intergenic
927315458 2:21676109-21676131 CTCTCCTTCCTGGAGAAAGTTGG - Intergenic
931318914 2:61157503-61157525 CTTTCCTTTTTGGCTTAAGCTGG - Intronic
931753098 2:65347967-65347989 TTCTATTTTCTGGGTTAAGTTGG - Intronic
932867185 2:75355977-75355999 CTCTCCTTTTTTGTTTAATCTGG + Intergenic
932986963 2:76737808-76737830 CTCTCTTTTTTGGTGTCAGTGGG - Intergenic
934623128 2:95828455-95828477 TTCTCATTTCTGGTTTCAGAGGG + Intergenic
934810635 2:97273632-97273654 TTCTCATTTCTGGTTTCAGAGGG - Intergenic
934827057 2:97434307-97434329 TTCTCATTTCTGGTTTCAGAGGG + Intergenic
935014771 2:99171338-99171360 CTCACCTCTCTGGATGAAGTAGG - Exonic
935200125 2:100849205-100849227 CTCTCTTCTCTGGTTTAGGGTGG + Intronic
935604938 2:104961918-104961940 CTTTCATTTCTGATTTAAATTGG + Intergenic
937480018 2:122248321-122248343 CTCTACTTTCTGATTTAAGTGGG + Intergenic
937635048 2:124146052-124146074 TTGTCCTATCTGCTTTAAGTGGG - Intronic
937960843 2:127457113-127457135 CTCTCCTGTGTGCTTTGAGTTGG - Intronic
938757612 2:134395233-134395255 ACCTCCTTTCTGCTTTAAGAAGG - Intronic
939194422 2:138954682-138954704 CTCTCCTTGATGTTGTAAGTGGG + Intergenic
939757507 2:146132400-146132422 CTCTGCTTTCTGGTTTCAAGCGG + Intergenic
940141501 2:150496274-150496296 CTCTCCTTTCTGGTCTAAATTGG + Intronic
942813645 2:180025485-180025507 CTCTCCTTGCAGGTTTTAGATGG + Intergenic
943260808 2:185660181-185660203 CTCTCCTTTTATGTTTTAGTTGG + Intergenic
943332771 2:186579668-186579690 CTCTGCTTTCTACTTTATGTTGG - Intergenic
943888750 2:193257806-193257828 CTATGCTTTCTGGTTGAAATGGG - Intergenic
944429699 2:199619866-199619888 CTCTCCTTTTAGGTTTATGTTGG + Intergenic
944938083 2:204590458-204590480 CTCTCCTTTATTGTTGATGTGGG + Intronic
944977873 2:205077857-205077879 CTCTCTTTTGTTGTTTAAATAGG - Intronic
945443477 2:209908580-209908602 CTCTCCTTTTTGGTTGAAAGAGG - Intronic
945555843 2:211274834-211274856 TTGTCCTTTCTGGTATAAGAGGG - Intergenic
947325445 2:228970191-228970213 TTCTCCTTTCTGTGTGAAGTAGG - Intronic
1170033803 20:11969466-11969488 CCCTCCCTTCTTGTTTCAGTTGG + Intergenic
1170916614 20:20632541-20632563 CTTTCCTCTCTGGTTTAAAAAGG - Intronic
1172776144 20:37408126-37408148 CTTTCCTTTCTGCCTTCAGTTGG + Intergenic
1182859240 22:33544918-33544940 CTCTCCTTGCTTGTTTCAGTTGG - Intronic
1185209872 22:49564817-49564839 CTCTCCTTTCTTGTTTCACTCGG + Intronic
949108479 3:229140-229162 CTCTGCTTTCTATTTTAAGGTGG + Intronic
952730026 3:36629071-36629093 GTCTCCATTCTCCTTTAAGTTGG - Intergenic
954030442 3:47815986-47816008 CTCTCCATTCCTGTTTAAGGAGG - Intronic
954645109 3:52126542-52126564 CTGTCCTTTCAGGATTCAGTGGG - Intronic
956805480 3:72806293-72806315 CTCTCCTTTCTTCGATAAGTTGG + Intronic
958774409 3:98464329-98464351 CTCTCCTTTTTGGTTTCTGAAGG - Intergenic
959352346 3:105281593-105281615 CTCTCCCTCCTGGTTTAATGAGG - Intergenic
960072697 3:113449600-113449622 GTCTTATTTCTGGTTGAAGTAGG - Intronic
960287469 3:115845609-115845631 CTCTCCTTTCTGCTTTCATGTGG + Intronic
961971879 3:130976777-130976799 ATCTCTTTTCTGGTTTACCTGGG + Intronic
962265324 3:133940390-133940412 CTCTCCTTTCTAGGTCGAGTTGG - Intronic
962669026 3:137686123-137686145 CTCTATTTTTTAGTTTAAGTTGG - Intergenic
964520133 3:157556668-157556690 CTCTGCTATCAGGTTAAAGTGGG - Intronic
965178610 3:165369375-165369397 GTGACCTTTCTGGATTAAGTCGG + Intergenic
967470392 3:189854163-189854185 CTCTCATTTGTGGTTTATGATGG + Intronic
970396789 4:15676079-15676101 ACCTCCTTTCTGGTTTTAGATGG - Intronic
973583552 4:52369083-52369105 CTCTGTTTCCTTGTTTAAGTGGG - Intergenic
974009568 4:56594549-56594571 CTCTCCTTTCTGGTTTAAGTAGG - Intronic
974046140 4:56900222-56900244 CTCTCCTTCCTCTATTAAGTTGG + Intergenic
975013332 4:69380958-69380980 CTGGGCTTTCTGGGTTAAGTAGG + Intronic
975151717 4:71029948-71029970 CTCTACTGTCTGGATTAATTAGG + Exonic
977458681 4:97297398-97297420 CTGTCCCTTCAGGGTTAAGTAGG + Intronic
978312355 4:107398450-107398472 CTCTCTTTACAGGTTTGAGTTGG + Intergenic
979363972 4:119798039-119798061 CTCTCCTCTGAGGTTTAAGAGGG - Intergenic
982546744 4:156742833-156742855 CTCTTCCTTTTGCTTTAAGTTGG + Intergenic
984203355 4:176755294-176755316 GTCTCCTGTCTGCTGTAAGTGGG - Intronic
984507243 4:180635256-180635278 CTCTCCTTTGTTGTTTAAAGAGG - Intergenic
988060835 5:26167473-26167495 ATCTTTTTTCGGGTTTAAGTAGG + Intergenic
989380167 5:40802568-40802590 GACTCCTTTCTAGTTTAAGTGGG + Intergenic
991647381 5:68814889-68814911 CCTTCCTTTCTCGTCTAAGTAGG - Intergenic
992943750 5:81789343-81789365 CTCTCATTTCTGGTTTAAACTGG + Intergenic
995427999 5:112045769-112045791 CTCTCCCATCTGGGATAAGTAGG + Intergenic
996684816 5:126268678-126268700 TTCTCCTTTCTGGTAACAGTGGG - Intergenic
997626314 5:135333416-135333438 ATCAACTTTCAGGTTTAAGTTGG + Intronic
1001404085 5:171463315-171463337 ATGTCCTTATTGGTTTAAGTCGG - Intergenic
1007930174 6:45683669-45683691 CTCTCCTTTCTGCTCTAAAGTGG + Intergenic
1010368884 6:75084753-75084775 CCCTCCTTTTTGGTTTTAGGAGG + Exonic
1012385242 6:98673531-98673553 CTCTCCTCTCTGTTTAATGTGGG - Intergenic
1012449771 6:99342933-99342955 ATCTCCTTTCTGTTTAAAGATGG - Exonic
1014658611 6:124138018-124138040 CTTTGCTTTTTAGTTTAAGTAGG - Intronic
1015380744 6:132565058-132565080 TTCTCCTTTCTTGTCTAATTTGG + Intergenic
1017810371 6:157979909-157979931 CTCTGCTGTCTGGTTTCAGGTGG - Intergenic
1018259068 6:161951575-161951597 CACTCCTCTCTGGTTTAGTTTGG + Intronic
1018388142 6:163322957-163322979 CTCTCCTGTCTGATTTAGGCAGG + Intergenic
1020625920 7:10579653-10579675 TTCTCCTTTCTCTTTCAAGTTGG - Intergenic
1020919848 7:14249691-14249713 CTTTCATTTCTGGTTTTAATTGG + Intronic
1021378098 7:19933713-19933735 TTCTGGTTTCTGGTCTAAGTTGG + Intergenic
1021709704 7:23403393-23403415 GTCTCCTTTCTGGTATTACTAGG + Intronic
1022632338 7:32097071-32097093 CTCTCCTCCCTGATTTAAGCTGG - Intronic
1023112311 7:36826341-36826363 CTCTCCATTCTGGTCTAGGCTGG - Intergenic
1023632530 7:42178513-42178535 CTCTCCTTTCTTCTTGAAGGGGG - Intronic
1023691239 7:42790118-42790140 CCTTCCTTACTGGTTTAAATTGG + Intergenic
1025820380 7:64957026-64957048 ATTTCCTTTCTGGTTAAAGAGGG + Intergenic
1027336191 7:77152996-77153018 CTCTCCTTCCTGGGTGACGTTGG - Intronic
1028941485 7:96526731-96526753 CTCTCCTTTCTCCTTTCAGAGGG + Intronic
1030561833 7:111096780-111096802 ATCTCCTTTCTGGTTTGTCTTGG + Intronic
1030704088 7:112673443-112673465 CTCTCCTTTCTTGTTAAAGGAGG - Intergenic
1031957248 7:127955091-127955113 CTCTCCTTTCTTGTTGAACAGGG + Intronic
1032349763 7:131149989-131150011 CTCTTCCTTCTCCTTTAAGTTGG + Intronic
1032713730 7:134486321-134486343 CTCTTATGTCTGGTTAAAGTGGG + Intergenic
1038553143 8:28486998-28487020 CTCTCCTTTCCAGTTTGTGTAGG + Intronic
1038620740 8:29140468-29140490 CTCTCCTTTCTGGTTGATGATGG + Exonic
1038936739 8:32260177-32260199 CTCACCATGCTGGTTTTAGTAGG + Intronic
1039870794 8:41543585-41543607 CTTTTCTTCCTGGTTGAAGTTGG + Exonic
1041576865 8:59407516-59407538 CTCTCATTTTGGTTTTAAGTTGG - Intergenic
1042346827 8:67736095-67736117 CTCTCCTTTCTCTGTAAAGTAGG - Intronic
1042647244 8:71000876-71000898 CTCTCATTTCTGCCTTTAGTGGG - Intergenic
1042725636 8:71872892-71872914 CTCTCATTTCTGATTTCATTTGG + Intronic
1044748470 8:95394152-95394174 CTCTCCTTTCAAGTTTGACTCGG + Intergenic
1045482389 8:102602432-102602454 CTCTTCTTTCTGGTTTTCGATGG - Intergenic
1045494993 8:102700642-102700664 CTCTCCTTTCTCTGTGAAGTAGG + Intergenic
1046064023 8:109175487-109175509 GTCTCCTTTTTGGTTATAGTGGG + Intergenic
1046301417 8:112296848-112296870 CTCTCCTTTTTGGTGTTAATAGG - Intronic
1046780395 8:118208888-118208910 CTCTCCTTCCTGCTGTATGTAGG + Intronic
1048523581 8:135180028-135180050 ATGTCCTTTCTGGTTTAGTTGGG + Intergenic
1049377379 8:142295705-142295727 TTCTCTTTACTGGTTTATGTTGG - Intronic
1050394713 9:5183702-5183724 CTTCCCTTTCTGCTTTATGTTGG - Intronic
1050528378 9:6565366-6565388 CTCTCCTTTCTGGTTTAAGTAGG + Exonic
1052524579 9:29598095-29598117 TTCTCTTTACTGGTTTAACTTGG - Intergenic
1053262190 9:36677832-36677854 TTTTCCTGTCTGATTTAAGTAGG + Intergenic
1056878299 9:90360785-90360807 CTCTCCTTTCTTGTCTTAATGGG + Intergenic
1057378876 9:94551000-94551022 CTGACCTTTTTGGTTTGAGTGGG - Intergenic
1057420312 9:94906961-94906983 CTCTCCTTTCTAGTATCAGCTGG - Intronic
1059016390 9:110520957-110520979 CTCTACTTTCTGCTATAAATAGG + Intronic
1059933656 9:119285898-119285920 TTTTCCTTCCTGGTATAAGTTGG - Intronic
1060008940 9:120026460-120026482 CTCTTCTATCAGGCTTAAGTGGG + Intergenic
1060967361 9:127719124-127719146 CTCTGCTTTCTGGTTTCAAGAGG - Intronic
1061485969 9:130920686-130920708 CTGGCCTATCTGGTTTAAGGAGG - Intronic
1185624319 X:1471946-1471968 CTCTCCTTTCTGTTTTCTGGGGG + Intronic
1186668196 X:11740825-11740847 CTCTTCTTTCTGTTTTATTTAGG + Intergenic
1187997191 X:24940361-24940383 CTCTGCTTTATTGTCTAAGTAGG + Intronic
1188886089 X:35551446-35551468 CTCTCCTTTGTGTTTTATGTAGG - Intergenic
1189605093 X:42668702-42668724 ATTTCTTTTCTGCTTTAAGTTGG - Intergenic
1189648384 X:43159611-43159633 CTCTCCTTCCTAATTTAAGAGGG + Intergenic
1189789321 X:44588409-44588431 CTGTCCCTTTTGGTTCAAGTCGG - Intergenic
1190710170 X:53062342-53062364 CTCTCCTGTCTGATTCAAATGGG - Intronic
1193120617 X:77819443-77819465 TTCTACTTTTGGGTTTAAGTTGG - Intergenic
1195109513 X:101632380-101632402 GACTCGTTTCTGGTTTTAGTGGG + Intergenic
1195669814 X:107460164-107460186 CTCTTCTTTCTGCCTTAAATGGG - Intergenic
1195922889 X:110001117-110001139 ATCACCTTTTTGGTTTTAGTGGG + Intergenic
1197147843 X:123188641-123188663 CTCTCCTATCTGGTTCAATATGG + Intronic
1199586663 X:149422091-149422113 CTCTTTTTTCTAGTTTAGGTAGG - Intergenic