ID: 974014179

View in Genome Browser
Species Human (GRCh38)
Location 4:56634055-56634077
Sequence GCGTGGGCCACTTTTTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974014179_974014183 0 Left 974014179 4:56634055-56634077 CCAAAAAAAAAAGTGGCCCACGC No data
Right 974014183 4:56634078-56634100 CTTCCAGAGCCACATCATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974014179 Original CRISPR GCGTGGGCCACTTTTTTTTT TGG (reversed) Intergenic
No off target data available for this crispr