ID: 974017418

View in Genome Browser
Species Human (GRCh38)
Location 4:56660859-56660881
Sequence TGGGACTCCGGGAAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 140}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974017418 Original CRISPR TGGGACTCCGGGAAAAAAAC AGG (reversed) Intronic
900037475 1:428796-428818 TAGAACTCCTGGAAGAAAACAGG - Intergenic
900956224 1:5887891-5887913 TGGGACTCCAGGAGGAAGACAGG + Intronic
901777299 1:11569035-11569057 TGGTACACAGGGAAGAAAACTGG - Intergenic
904625281 1:31798804-31798826 TGGGGCTCAGGGAAAATAAGAGG + Intronic
906132732 1:43470619-43470641 TAGGAGTCAGGGAAAAACACAGG + Intergenic
908608427 1:65826682-65826704 TGCGTCTTGGGGAAAAAAACAGG + Intronic
909957101 1:81791591-81791613 TGGCACACAGGAAAAAAAACGGG + Intronic
913280410 1:117180143-117180165 TGGGACTCTGGAAGGAAAACTGG + Intronic
918040004 1:180908226-180908248 TGGGAATCCTGGAAGGAAACAGG + Intergenic
918388802 1:184037212-184037234 GGCGACTCCGGGAAAACCACCGG + Exonic
919707966 1:200696896-200696918 TGGATTTCCGGGAGAAAAACTGG + Intergenic
919721324 1:200839688-200839710 GGGGACTCAGGGAAAAAAGCAGG + Intronic
920754625 1:208717267-208717289 AGGGTGTCTGGGAAAAAAACTGG - Intergenic
922368825 1:224889875-224889897 TGGGAGTGAAGGAAAAAAACTGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063350955 10:5354616-5354638 TGGGACTTTGGCAAAAAGACTGG - Intergenic
1063949621 10:11209777-11209799 TTGGACTCTGGAAAAAAAAAAGG + Intronic
1064716213 10:18179389-18179411 TGGGATGCAGGGAGAAAAACAGG - Intronic
1064929118 10:20604088-20604110 TGGGACTCTGGGAATGAAAGTGG - Intergenic
1069184150 10:65401557-65401579 TGGGACTCTAGGAAATAAAATGG + Intergenic
1071357260 10:84810610-84810632 TGGGACTCCTTGGAAAAAACAGG - Intergenic
1071691692 10:87826753-87826775 TGGGACTCTTGGAAATAAACAGG + Intronic
1079644732 11:22849473-22849495 TGGGACTTCAAGAAAAAAAGGGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084647932 11:70471460-70471482 AGGGACTCCGGGGAAAGAAAGGG + Intronic
1086412659 11:86558004-86558026 AGGGACTCCTGGAAATAAGCGGG + Intronic
1086731132 11:90250910-90250932 TGGAACTCAGGGAAAATACCTGG + Intergenic
1094044373 12:26151085-26151107 TGGAACTTAGGGAAAAAAAGGGG + Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096653183 12:53072308-53072330 TGGAACTCAGGGAAAATGACAGG - Intronic
1096732640 12:53626474-53626496 GGGGGCTCCGGGAAAAGAAGGGG + Intergenic
1098502359 12:71207566-71207588 TGAGACTCCTTGGAAAAAACAGG + Intronic
1099141959 12:78989238-78989260 TGGACCTCAGGGAAAAAGACTGG + Intronic
1099446734 12:82761684-82761706 TGGGACTCCTGGAAATAAAGAGG - Intronic
1100608612 12:96171901-96171923 GGAGATTCCAGGAAAAAAACAGG - Intergenic
1100782805 12:98047473-98047495 TGAGACTGGGGGAAAAAAAGAGG + Intergenic
1100972524 12:100086352-100086374 TTTGACTCTGGGAAAAAAAAAGG + Exonic
1102621431 12:114198159-114198181 TGGGAATGGAGGAAAAAAACAGG - Intergenic
1102760202 12:115378387-115378409 TAGCATTCAGGGAAAAAAACAGG + Intergenic
1107079407 13:36358439-36358461 TGGGACTATGAGAAAAAAATAGG - Intronic
1109195433 13:59373166-59373188 TGGGACTGGAGGAAAAACACAGG + Intergenic
1111693832 13:91597734-91597756 TTGGACCCCAGGACAAAAACAGG - Intronic
1112311633 13:98322363-98322385 AGGCACTCCAGGAAAAATACTGG + Intronic
1112828073 13:103414901-103414923 TGTGAGTCCTGGAATAAAACAGG - Intergenic
1113664059 13:112128566-112128588 TGAGGCTCCTGGAGAAAAACAGG - Intergenic
1114503251 14:23187804-23187826 TGGGACTCTGGGAAGAAAGTTGG - Intronic
1115775840 14:36714289-36714311 TGGGACTCTGGGAAAAGGAAAGG - Intronic
1116185659 14:41597893-41597915 TGGGGCTGCGGGAAGAAGACAGG - Intergenic
1121003805 14:90473395-90473417 TGGGACTCCTTGGCAAAAACAGG + Intergenic
1122245914 14:100403417-100403439 TGGGACTCCTGGGAAGGAACTGG + Intronic
1126009404 15:44288707-44288729 TGGGAGGCGGGGAAAAAAACCGG - Intronic
1126374638 15:47984711-47984733 GGGGACTCAGGGAAAAAGATGGG - Intergenic
1130764542 15:86856932-86856954 TGGGACTTCGGGACAAAACTAGG - Intronic
1132201806 15:99960088-99960110 TGAGGCTCAGGGAAAATAACAGG - Intergenic
1141052577 16:80784997-80785019 TGGTACACAGGGAAGAAAACGGG + Intronic
1143947063 17:10602614-10602636 TGGGACCACGTGAAAAAGACAGG - Intergenic
1144213563 17:13035102-13035124 TGGGACTCCCAGAAAAGTACAGG - Intergenic
1145889984 17:28407498-28407520 GGGGACTCCGGGACCACAACAGG + Intergenic
1148492534 17:48032595-48032617 GGGGACTTCAGGAGAAAAACAGG + Intronic
1153143973 18:2007751-2007773 TGGGGTGCCGGGAAAAAAATGGG + Intergenic
1155588985 18:27402943-27402965 TAGGCCTCAGGTAAAAAAACTGG + Intergenic
1156794049 18:41019037-41019059 TGAGACTGCTGGAAGAAAACAGG + Intergenic
1158027140 18:52913673-52913695 TGAGACTCTTGGGAAAAAACAGG - Intronic
1158156588 18:54432562-54432584 TGTTCCTCTGGGAAAAAAACAGG + Intergenic
1158330737 18:56359224-56359246 TGAGACTCGGGGAGAAAAAGAGG - Intergenic
1164446992 19:28326157-28326179 TGGGCCTCCTGGTAAAACACTGG - Intergenic
1166294495 19:41882498-41882520 TGGGAATCCGGGAGAGAGACAGG + Intergenic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166764462 19:45244670-45244692 AGGGACTCCGGGGAAAAGGCTGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
927799926 2:26089048-26089070 TGTGACTACAGGAGAAAAACTGG + Intronic
927889722 2:26740822-26740844 TGGGACTCCTCGAAAAAGATGGG - Intergenic
934129420 2:88933199-88933221 TGGGACCCGGGGCAAAAAAAGGG + Intergenic
935580798 2:104754585-104754607 TGGGACTCAGGTAAAAAGGCTGG - Intergenic
936227894 2:110674600-110674622 TGGGACTTATGGAAAAACACTGG - Intronic
939070963 2:137541992-137542014 CGGGAGTCCCGGAAAAAAAGAGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
944034387 2:195276075-195276097 TGGGAATTGGGAAAAAAAACTGG + Intergenic
946086346 2:217177101-217177123 TTGTAGTCCTGGAAAAAAACAGG + Intergenic
1169351170 20:4869098-4869120 GGGGAAACAGGGAAAAAAACAGG + Intronic
1170311126 20:14993095-14993117 CTGGACTCCAGGAAAGAAACAGG - Intronic
1178212457 21:30551858-30551880 TGAGACTCCGAAAAAAAAAATGG + Intronic
1179193542 21:39143680-39143702 TACCACTCCGGGTAAAAAACCGG - Intergenic
1182568223 22:31215494-31215516 TGAGGCTCAGGGAAAAAAAACGG + Intronic
1184569232 22:45311348-45311370 TGGGCCTCCGGGAGCAAAGCTGG - Intronic
949894739 3:8760717-8760739 TGGGAATCCGTGGAAGAAACTGG + Intronic
950264847 3:11565872-11565894 TGGGACCCCTGGAATAAAGCAGG - Intronic
950743864 3:15071428-15071450 TGGGCCTCAGGGAAGAAAAGAGG + Exonic
954611291 3:51945776-51945798 TGGGACTGGGGGAAGAAAAATGG + Intronic
956674763 3:71723890-71723912 TGGGTCTCCGGCAAAGAAAATGG + Intronic
960266695 3:115628235-115628257 TGGGGCTCTGGGGAAAACACGGG - Intronic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
964247979 3:154676257-154676279 TGGAATTCCAGGAAAAAAACGGG - Intergenic
965352830 3:167636118-167636140 GGGGACTCAGGGAAAAATAGTGG - Intronic
965707339 3:171522310-171522332 TGGGAGGCCTGGAAAAAATCAGG - Intergenic
965770066 3:172172597-172172619 TGGGAATCCAGCAAAAATACTGG + Intronic
967125433 3:186419062-186419084 TGGCACTCTGGGAAAACACCAGG + Intergenic
968798556 4:2726447-2726469 TGGGTTTCAGGGAAAAAAAAGGG + Intronic
969394076 4:6909586-6909608 TGGTTCTCCGGCAAAAAAAAAGG + Intronic
971814107 4:31464941-31464963 TGGGACTCCTTGGAAAAAACAGG - Intergenic
974017418 4:56660859-56660881 TGGGACTCCGGGAAAAAAACAGG - Intronic
975748197 4:77495032-77495054 TGGGACTGGGGGAATAGAACTGG - Intergenic
977269822 4:94903267-94903289 TGGGACTCGGGGATAAAAAAGGG - Intronic
977554050 4:98470934-98470956 TGGAACTCTGGGAAAACCACAGG - Exonic
983286785 4:165750094-165750116 TAGGACTCAGAGAAAAAAAATGG - Intergenic
983803736 4:171967834-171967856 TGAGAAGCCGGGAAAAAAATAGG - Intronic
984404531 4:179310448-179310470 TGGTACTCTGGCACAAAAACAGG - Intergenic
985496260 5:208262-208284 TGGGACCCCAGGAACAACACGGG + Intronic
992145975 5:73848306-73848328 TGGGACAACAGGAACAAAACCGG + Intronic
994670026 5:102754107-102754129 TGGGACTCTGGGAGAAAGAGAGG + Intronic
996254564 5:121383417-121383439 TGGGACTGGAGGAAGAAAACAGG + Intergenic
997628223 5:135345987-135346009 TGGAACTCCGGAAAAAGAACGGG - Exonic
1002736346 5:181390070-181390092 TAGAACTCCTGGAAGAAAACAGG + Intergenic
1005022496 6:21431652-21431674 TGGGACTCTAGGAAAAAAAGAGG + Intergenic
1007800228 6:44386049-44386071 TTGGACTAAGGGAAAAAAGCAGG - Intergenic
1008009823 6:46454366-46454388 TGGGACTCCAGAAAAAAAAGTGG - Intronic
1008081157 6:47195681-47195703 AGGGACTCTGGGAAGAAAATTGG - Intergenic
1011336033 6:86260599-86260621 TGAAACTCAGGGAGAAAAACAGG - Intergenic
1013488623 6:110621844-110621866 TGGGAATCCGGGAGTAGAACTGG + Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016392706 6:143591378-143591400 TGGAACACCTAGAAAAAAACAGG - Intronic
1016911486 6:149203319-149203341 TGGAACCCCAGGAGAAAAACAGG + Intergenic
1018456513 6:163958610-163958632 AGGGACTCGGGGAAAGAAAGCGG - Intergenic
1018801911 6:167229470-167229492 TGGTACTCCTTGAAAAAAACAGG + Intergenic
1023067228 7:36389928-36389950 TGTGTCTCCTGGAAAAAACCAGG - Exonic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1030112352 7:106037795-106037817 TAGGACTCGGGGACAAAAATAGG - Intergenic
1031255961 7:119449298-119449320 TGGCATTCCTGGAAAAAAAATGG - Intergenic
1031541319 7:122997779-122997801 TGGGACATTAGGAAAAAAACTGG - Intergenic
1033584605 7:142764806-142764828 TGGGACTCCTTAAAAAAAAGTGG + Intergenic
1035506672 8:142497-142519 TAGAACTCCTGGAAGAAAACAGG - Intergenic
1036245250 8:7110689-7110711 TGAGACTCTGGAAAAAAAAAAGG + Intergenic
1036980387 8:13463738-13463760 TGGGAATCCGGCAAAAAGTCAGG - Intronic
1038551476 8:28472938-28472960 TGGGTGTATGGGAAAAAAACTGG - Intronic
1039183774 8:34894178-34894200 TGGGACTCCTTGGAAAAAACAGG + Intergenic
1040418180 8:47214922-47214944 TGGGACTCTGAGAAAAACAGAGG - Intergenic
1042375265 8:68043599-68043621 TGGGACTCAGTGACAAAATCTGG - Intronic
1046579019 8:116068557-116068579 TGGGACTCCTTGAGACAAACAGG + Intergenic
1050126167 9:2358257-2358279 TGGGACTGCAGGAAAAACACAGG + Intergenic
1051049470 9:12914189-12914211 TGGGACTCTGAAAAAAAAAAAGG - Intergenic
1053359268 9:37472430-37472452 AGTGTCTCCGGGAAGAAAACTGG - Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1057070490 9:92095110-92095132 TGGGAATCCAGTAAAAAAACAGG + Intronic
1057646287 9:96877692-96877714 CGGGACAGCGGGAAAGAAACTGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1059280074 9:113125325-113125347 TGAGATTACAGGAAAAAAACAGG - Intergenic
1061487855 9:130929327-130929349 CGGGTCACCGGGAAAGAAACAGG + Intronic
1189037958 X:37512123-37512145 TGCGACTCCAGGAGAGAAACGGG + Intronic
1191251517 X:58262268-58262290 AGGCACTTCGGGAAAAAAAGTGG + Intergenic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1194088332 X:89556012-89556034 TGGGACTCCAGGAGAAAGAGAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1194508067 X:94758078-94758100 TGGGACTCAGTGTAAAAAAATGG - Intergenic
1197551277 X:127895711-127895733 TGAGAGTCCTGGAAAAAAACAGG + Intergenic
1198181978 X:134219230-134219252 TGGGACTCCTTGAGAAAAACAGG - Intergenic
1200441004 Y:3212054-3212076 TGGGACTCCAGGAGAAAGAGAGG - Intergenic