ID: 974019531

View in Genome Browser
Species Human (GRCh38)
Location 4:56680412-56680434
Sequence GAGAACAAAACGAAGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 186}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974019531_974019540 26 Left 974019531 4:56680412-56680434 CCCAGCACCTTCGTTTTGTTCTC 0: 1
1: 0
2: 0
3: 16
4: 186
Right 974019540 4:56680461-56680483 ACTTAACTAAACACACTACAGGG 0: 1
1: 0
2: 0
3: 10
4: 144
974019531_974019539 25 Left 974019531 4:56680412-56680434 CCCAGCACCTTCGTTTTGTTCTC 0: 1
1: 0
2: 0
3: 16
4: 186
Right 974019539 4:56680460-56680482 TACTTAACTAAACACACTACAGG 0: 1
1: 0
2: 0
3: 4
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974019531 Original CRISPR GAGAACAAAACGAAGGTGCT GGG (reversed) Intronic
902107921 1:14053040-14053062 TAGAACACAGCGAAGGTGGTGGG + Intergenic
903149799 1:21398594-21398616 GAGAACAAAAGGAAGAGGCTGGG - Intergenic
903167773 1:21532950-21532972 GAGAAAAAGATGAAGGTGTTGGG + Intronic
904470140 1:30730867-30730889 GAGTAGAAAAAAAAGGTGCTTGG + Intergenic
905970771 1:42140634-42140656 GAACACAAAAGGAAGGTGCAGGG + Intergenic
906396809 1:45473248-45473270 AAGCACAAAAAGAAGGTGCCTGG - Intronic
908170497 1:61499895-61499917 TAGAAAAAAAGGAAGGAGCTGGG + Intergenic
909969677 1:81966664-81966686 GAAAGCAAAACTGAGGTGCTGGG + Intronic
909981455 1:82106693-82106715 GAAAACAAAACTGAGGTGATTGG - Intergenic
910197726 1:84661120-84661142 GAGAAAAAAAGGTAAGTGCTGGG + Intronic
910442538 1:87267410-87267432 GAGAACAAATTGCAGGTGATTGG - Intergenic
913079655 1:115370768-115370790 GAGAACCAAAGGAAGGGGATTGG - Intergenic
913448288 1:118973097-118973119 GATAACAAATCTAAGGTGCTTGG - Intronic
914673578 1:149890493-149890515 GAGAACAAAACCCAGATGATAGG + Intronic
915326282 1:155082680-155082702 GAGAACAGTACGAAGGGGCAGGG + Intronic
915730984 1:158054238-158054260 GAGAAGAAAAAGAAAGTGGTGGG + Intronic
917241069 1:172949349-172949371 GAGAACAAAACGAAGCTAACTGG - Intergenic
919669275 1:200324120-200324142 GAGAACACAGCAAAGGTGATGGG + Intergenic
920691601 1:208151032-208151054 GGGAACAAGACGAAGCTGCCAGG + Intronic
1065026910 10:21547306-21547328 TTGAACAAAACAAAGGTCCTTGG + Intronic
1065939765 10:30553745-30553767 GAGAAGAAAAAGAAGGGGGTAGG - Intergenic
1066433968 10:35379671-35379693 GAGAACAAAGCGAAGCTTGTGGG + Intronic
1068435566 10:56986609-56986631 GAGAACAACACTAAGTTGCAGGG - Intergenic
1068787800 10:60995982-60996004 GAGAATAAAATGAAGTTGTTTGG - Intronic
1070806033 10:79271254-79271276 GAGAACAACAGGATGGTCCTGGG - Intronic
1071294901 10:84212366-84212388 CAGAAGAAGACGATGGTGCTAGG + Exonic
1071387303 10:85134318-85134340 GTGAACAAAACAAAGGTGCAAGG - Intergenic
1071867546 10:89752638-89752660 GAGAACAACACAGATGTGCTTGG + Exonic
1072021628 10:91409495-91409517 GAGAGCAAAACGTAGGCGCGTGG + Intergenic
1072754871 10:98012676-98012698 GAGACCAAAATGAAGGGGCTGGG + Intronic
1073895140 10:108146753-108146775 GAGAATAAAAAGGAGGTGATGGG + Intergenic
1080399998 11:31925478-31925500 GAGAAGAAAACCAAGGTCCTGGG - Intronic
1083661641 11:64254236-64254258 CAGAACAAAGCCAAGGTCCTAGG - Intronic
1084142237 11:67240298-67240320 GAAAACAAAACAAAGACGCTGGG + Intronic
1088502332 11:110494921-110494943 GAGTACAAAATTAAGGTGTTGGG + Intergenic
1090372760 11:126268408-126268430 AACAACAAAACCAAGCTGCTGGG + Intronic
1090511821 11:127383670-127383692 GAGACAAAAAGGAAGGAGCTGGG - Intergenic
1090514860 11:127413556-127413578 GAAACCAAAACCAGGGTGCTAGG - Intergenic
1092018181 12:5177270-5177292 GAGAAGAAAACGCTGGTGATTGG - Intergenic
1094266765 12:28568510-28568532 GAGAAAAGAAGGAAGGTGATGGG - Intronic
1098361846 12:69661920-69661942 GAGAACATAACCAGGGTGGTAGG - Intronic
1099200609 12:79672402-79672424 GAAAACAAAACAAAAGTTCTAGG - Intronic
1099269862 12:80494890-80494912 GAGAAAAAAAGAAAGGTGTTTGG - Intronic
1100863521 12:98831999-98832021 GAGAACCAGATGAATGTGCTTGG + Intronic
1100904582 12:99283039-99283061 GAGAATAAAAGGAAGCAGCTGGG + Intronic
1102008716 12:109605234-109605256 GACAACAGAAGGCAGGTGCTCGG - Intergenic
1102987870 12:117293240-117293262 GGGAACACACGGAAGGTGCTAGG + Intronic
1103468072 12:121157815-121157837 GAGAACAAAACCTAGCTGTTCGG + Intronic
1104617158 12:130280413-130280435 GAGAAGGAAATGAAAGTGCTCGG - Intergenic
1106881879 13:34140329-34140351 GAGTACAAAAGGAAGGAGGTAGG + Intergenic
1108365365 13:49706137-49706159 GAACACAAAAAGAAGCTGCTTGG - Exonic
1110519252 13:76456063-76456085 GAAAACAAATTGAAGGAGCTTGG + Intergenic
1111586878 13:90292786-90292808 GAGAACAAAAGGATTGTTCTGGG - Intergenic
1112031094 13:95457418-95457440 GAGGACCAAAGCAAGGTGCTGGG + Intronic
1115056902 14:29139401-29139423 GAGAACAAAAAGAATATACTTGG - Intergenic
1115334011 14:32227445-32227467 CAGAACAAAATGATGGAGCTAGG - Intergenic
1116099743 14:40418228-40418250 GAGAACAAAAGGAAGACGTTGGG - Intergenic
1119187400 14:72652441-72652463 GAGACCAGAAGGATGGTGCTGGG + Intronic
1119894565 14:78209059-78209081 GAAAACAAAACCAACCTGCTGGG - Intergenic
1120184990 14:81385094-81385116 CAGAAAAAAATGTAGGTGCTGGG - Intronic
1121539411 14:94713778-94713800 GAGAACAAAGAGAGGGTCCTTGG - Intergenic
1122867963 14:104617775-104617797 GAGAATAAAGGGGAGGTGCTGGG - Intergenic
1122874637 14:104658323-104658345 GAGAACAAGATGGAGGTGCGTGG - Intergenic
1123166318 14:106328468-106328490 GAGAACAAAAGGAAATTTCTAGG - Intergenic
1124174066 15:27405766-27405788 GAGACCAAGACAAGGGTGCTGGG - Intronic
1125097035 15:35866823-35866845 GAAGAGAAAACCAAGGTGCTGGG - Intergenic
1125475186 15:40043159-40043181 AAGAGCAAAACGAAGGCCCTGGG + Intergenic
1132632160 16:923421-923443 GAGACCAAGACGTGGGTGCTGGG - Intronic
1133284594 16:4684648-4684670 GAGCAGAGCACGAAGGTGCTTGG - Intronic
1135229232 16:20690095-20690117 GAAAAGAAAAAGAAGGTGGTGGG + Intronic
1140894528 16:79313521-79313543 GAGAACAAAATGAAAATGATAGG - Intergenic
1142930129 17:3277260-3277282 GAGAAGAAAATGAAGGTGAAAGG + Intergenic
1143699232 17:8645809-8645831 AATAACAAAACAAAAGTGCTCGG + Intergenic
1144296189 17:13877159-13877181 GAGAACATTACCAAGGTGCATGG - Intergenic
1147243807 17:39107907-39107929 GATAACAAAACGACAGTGCTTGG - Intronic
1148628203 17:49086631-49086653 GAGAACAACACTGAGGTGCTGGG + Intergenic
1148714385 17:49705407-49705429 GAGGACAAAAGGAGGGTGCCAGG + Intronic
1150854478 17:68737964-68737986 GAGAACCAAATGAGGTTGCTTGG + Intergenic
1152131872 17:78482319-78482341 GGGAAAAAAACAAAAGTGCTGGG - Intronic
1152550170 17:81025720-81025742 GAGAAGAAAAAGAACTTGCTGGG + Intergenic
1153517228 18:5915137-5915159 GAGCACAGAAGGAAAGTGCTGGG + Intergenic
1153737285 18:8083931-8083953 GAGAGCAAAACTAAGGAGTTTGG + Intronic
1155060592 18:22224657-22224679 GATAAAAACAAGAAGGTGCTTGG - Intergenic
1155171852 18:23272595-23272617 GTGAACAAGAGGAAGGAGCTAGG + Intronic
1155993134 18:32301707-32301729 GAGAACAAAGGGAAGGTCCCGGG - Intronic
924975520 2:171065-171087 GAAAACAAAATGAAGATACTGGG + Intergenic
925050536 2:811366-811388 GCCAACAACACGAAGGAGCTTGG - Intergenic
926325608 2:11783124-11783146 GAAAACCACACGAAGCTGCTGGG - Intronic
926700797 2:15801981-15802003 CAGAACAACACAAAGGGGCTGGG - Intergenic
928025887 2:27738268-27738290 GGGAAAAAAAAGAGGGTGCTGGG - Intergenic
928517342 2:32056103-32056125 AAGGACAAAAAGAAGGAGCTAGG - Intergenic
929193512 2:39162357-39162379 GAGGACAACAGGAGGGTGCTGGG - Intergenic
929366304 2:41160434-41160456 GTGAACAGGAGGAAGGTGCTTGG + Intergenic
931408717 2:62006770-62006792 GAAAACACAACAAAGGTGTTAGG - Intronic
931464280 2:62473252-62473274 GATAAGAAAACTAAGGTACTGGG + Intergenic
931708444 2:64967435-64967457 GGGAACAAAACCAAGTGGCTGGG - Intergenic
935209227 2:100924017-100924039 GAGATCAAAGGGAAGCTGCTTGG - Intronic
938867677 2:135440638-135440660 GTGAACAAAAAGAAGGAGCTTGG + Intronic
940345333 2:152622875-152622897 AAGAACAAAAAAAAGGTGCCAGG + Intronic
1169711210 20:8565766-8565788 GAGGACAAAACACAGGTTCTGGG - Intronic
1174464695 20:50708187-50708209 GAGAATAAATGGAAAGTGCTGGG - Intergenic
1174536849 20:51257932-51257954 CAGAAAAAAAAGAAAGTGCTAGG + Intergenic
1175357843 20:58382961-58382983 GAGAACATAGGGAAGATGCTGGG - Intergenic
1177335377 21:19718271-19718293 GAGATCAAAGCAAAGCTGCTTGG - Intergenic
1179629443 21:42667491-42667513 GAGAACAAAACAAACATACTGGG - Intronic
1180170947 21:46057860-46057882 GACGTCCAAACGAAGGTGCTGGG + Intergenic
1180752799 22:18136748-18136770 GAGAGCAAAGCAAAGGGGCTTGG + Intronic
1181613832 22:24038058-24038080 GTGAACAACATCAAGGTGCTGGG - Intronic
1182433922 22:30318164-30318186 AAGAACAGAATAAAGGTGCTAGG + Intronic
1183240738 22:36656549-36656571 GAGAACACAATGTAGGGGCTGGG - Intronic
1184214109 22:43055017-43055039 AAAAACAAAAAGAAGGGGCTGGG - Intronic
954265636 3:49468980-49469002 GACAAGAAAAGGAAGGGGCTAGG - Intronic
956051278 3:65251158-65251180 GAGAACAAAACCTTGGGGCTGGG - Intergenic
956671284 3:71693396-71693418 GAGAACAAGACGAAGGGGTTAGG + Intronic
957829148 3:85492845-85492867 GAGCACAAGACAGAGGTGCTAGG + Intronic
959207864 3:103335694-103335716 GAGAAAAAAACAAAGTTGCTAGG - Intergenic
959331591 3:105012760-105012782 GAGAAGAAAATGTAGGTGCTGGG + Intergenic
960361707 3:116720070-116720092 GAGACCAAAAATAATGTGCTAGG + Intronic
967121112 3:186383660-186383682 CAGAAAAAAACGAAAGTCCTGGG + Intergenic
967521926 3:190441798-190441820 GACAACAAATCGTAGGTGTTTGG + Intronic
967536795 3:190613973-190613995 GGAAACAAAACAAAGGTTCTTGG + Intronic
969819374 4:9708644-9708666 AACAACAAAAAGAAGATGCTTGG + Intergenic
970231451 4:13915451-13915473 GAGGACAAAAGGGAGGTGGTGGG - Intergenic
971226414 4:24756802-24756824 GAGGACATACTGAAGGTGCTGGG - Intergenic
972612606 4:40669390-40669412 GAGAAAAAAAAAAAGATGCTGGG - Intergenic
973323677 4:48835581-48835603 CAAAACAAAACCAAGGTGCTGGG - Intronic
973334742 4:48944640-48944662 GGGAACAAAAGGAAGTTGCTGGG + Intergenic
974019531 4:56680412-56680434 GAGAACAAAACGAAGGTGCTGGG - Intronic
974449028 4:62026631-62026653 GAGAACAAAACACAGGGGCAGGG + Intronic
978655550 4:111061609-111061631 TAGAACAAAACCAAAGTGGTGGG + Intergenic
979884261 4:126004936-126004958 GAGAACGAAAGGAAGAGGCTGGG + Intergenic
980001388 4:127493328-127493350 GAAAAAAAAACGAAGTTGATAGG + Intergenic
981227529 4:142314177-142314199 GAGAAGAACAAGAAGGTACTGGG - Intronic
983327770 4:166280804-166280826 GTGTACAGAACGAAGGTTCTTGG - Intergenic
990862499 5:60342493-60342515 GAGAATGAAACCAAAGTGCTGGG + Intronic
992694651 5:79274122-79274144 TAGAAAAAAAAGAAAGTGCTGGG - Intronic
995760430 5:115556192-115556214 GAAAACAAGACCAAGGTGGTGGG - Intergenic
995823313 5:116263753-116263775 GAGAACAAAAAGTAGGGGCGCGG - Intronic
997440001 5:133902493-133902515 GAAAAGAAAAAGAAGTTGCTAGG + Intergenic
999841350 5:155430959-155430981 CAGAACAAAACGATGGTGGAAGG + Intergenic
1001018259 5:168161094-168161116 GAGAAAAGAAGGAAGATGCTAGG + Intronic
1001465208 5:171958125-171958147 GAGAACAAATGTAAAGTGCTGGG - Intronic
1001674378 5:173499905-173499927 GAGAACCAAACCAGGGTTCTGGG + Intergenic
1001803406 5:174562982-174563004 GAGAAACAAATGAAAGTGCTGGG - Intergenic
1003719027 6:8679349-8679371 GGGAAAAAAATGAAAGTGCTAGG + Intergenic
1005310085 6:24550769-24550791 TAGAAAAAAAAGCAGGTGCTGGG + Intronic
1005678969 6:28185772-28185794 GAGAACAAAATCTGGGTGCTAGG + Intergenic
1005882080 6:30069548-30069570 GAGAACAAAAGGAAGACACTGGG - Exonic
1006494553 6:34412743-34412765 GTGAACAATACGAAGGTGGGAGG - Intronic
1006590803 6:35155359-35155381 TAGAACAAAAAGAAGCTGATAGG - Intergenic
1006876729 6:37303975-37303997 GACACCAAAATGAAGGTACTGGG - Intronic
1007593883 6:43039607-43039629 GAGAACAAAGGGCAGGAGCTTGG - Intronic
1008302984 6:49865561-49865583 GAAAACAAAAGGAAGGTGGTTGG + Intronic
1008884598 6:56418441-56418463 GAGACCAAAGAGAAGGTCCTAGG - Intergenic
1010823760 6:80448051-80448073 GAGAGTTAAACGGAGGTGCTGGG + Intergenic
1011798927 6:90988351-90988373 AAGGACCAAATGAAGGTGCTGGG - Intergenic
1012126175 6:95430418-95430440 TAGAAAAAAAAAAAGGTGCTGGG + Intergenic
1015621789 6:135139654-135139676 GAGAAGAAGAGAAAGGTGCTAGG + Intergenic
1018161205 6:161044527-161044549 GAGAACAACACTAGGGTGTTGGG - Intronic
1020626153 7:10581955-10581977 GTGAACAAAACTAAGGTTCATGG + Intergenic
1021853011 7:24826938-24826960 GACAACAAAATCAAGGGGCTTGG + Intronic
1022942273 7:35252481-35252503 GAGATCAAAAATAAGGTGTTTGG - Intronic
1023578115 7:41651887-41651909 GAGAGCAAAATGAAGGTGGTGGG - Intergenic
1023783512 7:43681927-43681949 GAGAATGAAAAGAAGGTGTTAGG - Intronic
1024200141 7:47098118-47098140 TAGAACAGAAGGAAGGGGCTGGG - Intergenic
1031065383 7:117099075-117099097 AAGAAGAAGAAGAAGGTGCTTGG + Intronic
1031131024 7:117833241-117833263 GAAACCACAATGAAGGTGCTGGG + Intronic
1032923796 7:136578710-136578732 AAGAACAAAATGAAGTTGGTTGG - Intergenic
1035076217 7:156179239-156179261 GAGAGCAACAGGAAGCTGCTTGG + Intergenic
1035471743 7:159114399-159114421 GAGAAACAAACAAAAGTGCTCGG + Intronic
1035792235 8:2317589-2317611 GAGAAAAACATGAAGATGCTTGG + Intergenic
1035800570 8:2404116-2404138 GAGAAAAACATGAAGATGCTTGG - Intergenic
1036545315 8:9762940-9762962 GAGAAAAAAATGAAGATGTTTGG - Intronic
1036795640 8:11754516-11754538 GAAAACAAAAAGTGGGTGCTAGG - Intronic
1037433651 8:18840621-18840643 GAAAACAAAGCACAGGTGCTAGG + Intronic
1037499285 8:19469936-19469958 AAGAAGAAAGGGAAGGTGCTTGG + Intronic
1038932876 8:32214745-32214767 GAAAACAAAACAAACCTGCTGGG + Intronic
1042529973 8:69804695-69804717 GAAAACAAAGGGAAGGTGATTGG + Intronic
1043058797 8:75473979-75474001 GAGAACAAAAAGTAGGAGTTAGG + Intronic
1043295665 8:78659622-78659644 GAGAACAAAAAGAAGGAGAATGG + Intergenic
1045109692 8:98928668-98928690 GAGAAGAAAAGAATGGTGCTTGG - Intronic
1045649499 8:104328884-104328906 GGGAACAAAATGCAGGAGCTGGG + Intergenic
1045709935 8:104971300-104971322 GAGAAAAAAAAAAAGCTGCTAGG - Intronic
1047330821 8:123885162-123885184 AAGTCCAAAACTAAGGTGCTGGG - Intronic
1048502611 8:134992495-134992517 GAGATCCACACGAAGGTGCATGG - Intergenic
1051184807 9:14448998-14449020 GTGAAGAAAAGGAAGTTGCTGGG + Intergenic
1052828659 9:33196923-33196945 GGGAATAAAACAAAGTTGCTTGG - Intergenic
1053091642 9:35283601-35283623 GAGAGCAAAACAAAGATCCTGGG + Intronic
1054777944 9:69139556-69139578 GAGTCCAAGACCAAGGTGCTGGG - Intronic
1055870166 9:80867547-80867569 GAGAACAAAACAGTGGTTCTGGG - Intergenic
1058259557 9:102812117-102812139 TAGAAGAAAACAAAGGTGTTGGG + Intergenic
1059216335 9:112567371-112567393 GAGAACATCAGGAAGGAGCTTGG - Intronic
1059714471 9:116900777-116900799 GAGAACCAAACGAAGGTGGAGGG - Intronic
1061289191 9:129641292-129641314 GAGAGCAGAAGGAAGGGGCTCGG - Intronic
1186216547 X:7307134-7307156 GAGACCTAAAGGAAGGGGCTGGG - Intronic
1186506376 X:10096334-10096356 TAGAACAGAACAAAGGTGATGGG - Intronic
1189518188 X:41737110-41737132 GAGCAAAAATGGAAGGTGCTAGG - Intronic
1194967353 X:100303773-100303795 GAGAACAAAAAGAAAGTTTTAGG - Intronic
1197226663 X:123961529-123961551 GAGAGCAAAATGGTGGTGCTGGG + Intronic
1198436870 X:136625624-136625646 GAGAACAAAATTAAGATGCCAGG - Intergenic
1200254023 X:154569697-154569719 GAGGAGAAAATGATGGTGCTCGG - Intergenic
1200263746 X:154634711-154634733 GAGGAGAAAATGATGGTGCTCGG + Intergenic
1202067965 Y:20960331-20960353 GAGAACAGAAGGATGGTGCCTGG - Intergenic