ID: 974019926

View in Genome Browser
Species Human (GRCh38)
Location 4:56683983-56684005
Sequence TGGTTCCTCTCCTGGGTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974019919_974019926 14 Left 974019919 4:56683946-56683968 CCATCATTTTCAAAGAGGAAAGG No data
Right 974019926 4:56683983-56684005 TGGTTCCTCTCCTGGGTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974019926 Original CRISPR TGGTTCCTCTCCTGGGTCTA AGG Intergenic