ID: 974021045

View in Genome Browser
Species Human (GRCh38)
Location 4:56692773-56692795
Sequence GGCCATGGTCCTTGTGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974021045_974021047 -7 Left 974021045 4:56692773-56692795 CCAAGCACACAAGGACCATGGCC No data
Right 974021047 4:56692789-56692811 CATGGCCAGCAGATGCCCACTGG No data
974021045_974021048 -6 Left 974021045 4:56692773-56692795 CCAAGCACACAAGGACCATGGCC No data
Right 974021048 4:56692790-56692812 ATGGCCAGCAGATGCCCACTGGG No data
974021045_974021053 30 Left 974021045 4:56692773-56692795 CCAAGCACACAAGGACCATGGCC No data
Right 974021053 4:56692826-56692848 TTAGTGCTTGTAAAGCTCCCTGG No data
974021045_974021050 0 Left 974021045 4:56692773-56692795 CCAAGCACACAAGGACCATGGCC No data
Right 974021050 4:56692796-56692818 AGCAGATGCCCACTGGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974021045 Original CRISPR GGCCATGGTCCTTGTGTGCT TGG (reversed) Intergenic
No off target data available for this crispr