ID: 974031968

View in Genome Browser
Species Human (GRCh38)
Location 4:56784344-56784366
Sequence AGTCCCTTCCTCATTCCTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974031966_974031968 0 Left 974031966 4:56784321-56784343 CCGGAGACCAGGAAATCTCTGAC No data
Right 974031968 4:56784344-56784366 AGTCCCTTCCTCATTCCTACAGG No data
974031965_974031968 1 Left 974031965 4:56784320-56784342 CCCGGAGACCAGGAAATCTCTGA No data
Right 974031968 4:56784344-56784366 AGTCCCTTCCTCATTCCTACAGG No data
974031967_974031968 -7 Left 974031967 4:56784328-56784350 CCAGGAAATCTCTGACAGTCCCT No data
Right 974031968 4:56784344-56784366 AGTCCCTTCCTCATTCCTACAGG No data
974031958_974031968 28 Left 974031958 4:56784293-56784315 CCTTGCCTCTGCTCTTCCTTGGT No data
Right 974031968 4:56784344-56784366 AGTCCCTTCCTCATTCCTACAGG No data
974031964_974031968 2 Left 974031964 4:56784319-56784341 CCCCGGAGACCAGGAAATCTCTG No data
Right 974031968 4:56784344-56784366 AGTCCCTTCCTCATTCCTACAGG No data
974031961_974031968 12 Left 974031961 4:56784309-56784331 CCTTGGTGACCCCCGGAGACCAG No data
Right 974031968 4:56784344-56784366 AGTCCCTTCCTCATTCCTACAGG No data
974031959_974031968 23 Left 974031959 4:56784298-56784320 CCTCTGCTCTTCCTTGGTGACCC No data
Right 974031968 4:56784344-56784366 AGTCCCTTCCTCATTCCTACAGG No data
974031963_974031968 3 Left 974031963 4:56784318-56784340 CCCCCGGAGACCAGGAAATCTCT No data
Right 974031968 4:56784344-56784366 AGTCCCTTCCTCATTCCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974031968 Original CRISPR AGTCCCTTCCTCATTCCTAC AGG Intergenic
No off target data available for this crispr