ID: 974036461

View in Genome Browser
Species Human (GRCh38)
Location 4:56821974-56821996
Sequence TCTTCCCCTTCGTCTCCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974036461_974036470 19 Left 974036461 4:56821974-56821996 CCCCAAGGAGACGAAGGGGAAGA No data
Right 974036470 4:56822016-56822038 AGAACCTGTGACAGTCCTAGGGG 0: 1
1: 0
2: 1
3: 12
4: 96
974036461_974036471 20 Left 974036461 4:56821974-56821996 CCCCAAGGAGACGAAGGGGAAGA No data
Right 974036471 4:56822017-56822039 GAACCTGTGACAGTCCTAGGGGG No data
974036461_974036473 30 Left 974036461 4:56821974-56821996 CCCCAAGGAGACGAAGGGGAAGA No data
Right 974036473 4:56822027-56822049 CAGTCCTAGGGGGACCCTTGTGG No data
974036461_974036468 17 Left 974036461 4:56821974-56821996 CCCCAAGGAGACGAAGGGGAAGA No data
Right 974036468 4:56822014-56822036 CAAGAACCTGTGACAGTCCTAGG No data
974036461_974036469 18 Left 974036461 4:56821974-56821996 CCCCAAGGAGACGAAGGGGAAGA No data
Right 974036469 4:56822015-56822037 AAGAACCTGTGACAGTCCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974036461 Original CRISPR TCTTCCCCTTCGTCTCCTTG GGG (reversed) Intergenic
No off target data available for this crispr