ID: 974040425

View in Genome Browser
Species Human (GRCh38)
Location 4:56852583-56852605
Sequence CCGCGCCCGGCCCATGCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974040418_974040425 11 Left 974040418 4:56852549-56852571 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 974040425 4:56852583-56852605 CCGCGCCCGGCCCATGCCAGTGG No data
974040414_974040425 21 Left 974040414 4:56852539-56852561 CCTGCCTTGGCCTCCCAAAGTGC 0: 56485
1: 171609
2: 226607
3: 184242
4: 115036
Right 974040425 4:56852583-56852605 CCGCGCCCGGCCCATGCCAGTGG No data
974040413_974040425 24 Left 974040413 4:56852536-56852558 CCACCTGCCTTGGCCTCCCAAAG 0: 25113
1: 73031
2: 147530
3: 156446
4: 127492
Right 974040425 4:56852583-56852605 CCGCGCCCGGCCCATGCCAGTGG No data
974040421_974040425 7 Left 974040421 4:56852553-56852575 CCAAAGTGCTGGGATTACAGGTA 0: 4761
1: 166787
2: 306278
3: 212252
4: 197042
Right 974040425 4:56852583-56852605 CCGCGCCCGGCCCATGCCAGTGG No data
974040420_974040425 8 Left 974040420 4:56852552-56852574 CCCAAAGTGCTGGGATTACAGGT 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
Right 974040425 4:56852583-56852605 CCGCGCCCGGCCCATGCCAGTGG No data
974040416_974040425 17 Left 974040416 4:56852543-56852565 CCTTGGCCTCCCAAAGTGCTGGG 0: 79234
1: 201556
2: 232767
3: 156913
4: 93134
Right 974040425 4:56852583-56852605 CCGCGCCCGGCCCATGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974040425 Original CRISPR CCGCGCCCGGCCCATGCCAG TGG Intergenic
No off target data available for this crispr