ID: 974041409

View in Genome Browser
Species Human (GRCh38)
Location 4:56861004-56861026
Sequence TTGTCTAAAAATCTGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974041404_974041409 10 Left 974041404 4:56860971-56860993 CCAGTCTTATAGATTCCTGACCT No data
Right 974041409 4:56861004-56861026 TTGTCTAAAAATCTGCAGCCTGG No data
974041400_974041409 18 Left 974041400 4:56860963-56860985 CCCAAACCCCAGTCTTATAGATT No data
Right 974041409 4:56861004-56861026 TTGTCTAAAAATCTGCAGCCTGG No data
974041401_974041409 17 Left 974041401 4:56860964-56860986 CCAAACCCCAGTCTTATAGATTC No data
Right 974041409 4:56861004-56861026 TTGTCTAAAAATCTGCAGCCTGG No data
974041405_974041409 -5 Left 974041405 4:56860986-56861008 CCTGACCTGACTTTGCCCTTGTC No data
Right 974041409 4:56861004-56861026 TTGTCTAAAAATCTGCAGCCTGG No data
974041406_974041409 -10 Left 974041406 4:56860991-56861013 CCTGACTTTGCCCTTGTCTAAAA No data
Right 974041409 4:56861004-56861026 TTGTCTAAAAATCTGCAGCCTGG No data
974041403_974041409 11 Left 974041403 4:56860970-56860992 CCCAGTCTTATAGATTCCTGACC No data
Right 974041409 4:56861004-56861026 TTGTCTAAAAATCTGCAGCCTGG No data
974041402_974041409 12 Left 974041402 4:56860969-56860991 CCCCAGTCTTATAGATTCCTGAC No data
Right 974041409 4:56861004-56861026 TTGTCTAAAAATCTGCAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974041409 Original CRISPR TTGTCTAAAAATCTGCAGCC TGG Intergenic
No off target data available for this crispr