ID: 974041984

View in Genome Browser
Species Human (GRCh38)
Location 4:56865365-56865387
Sequence CACTTGAATCTGGGCGACGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974041984_974041992 17 Left 974041984 4:56865365-56865387 CCTCCGTCGCCCAGATTCAAGTG No data
Right 974041992 4:56865405-56865427 TCCCGAGTAGCTGGGATTACAGG 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
974041984_974041988 8 Left 974041984 4:56865365-56865387 CCTCCGTCGCCCAGATTCAAGTG No data
Right 974041988 4:56865396-56865418 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
974041984_974041990 9 Left 974041984 4:56865365-56865387 CCTCCGTCGCCCAGATTCAAGTG No data
Right 974041990 4:56865397-56865419 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974041984 Original CRISPR CACTTGAATCTGGGCGACGG AGG (reversed) Intergenic
No off target data available for this crispr