ID: 974046928

View in Genome Browser
Species Human (GRCh38)
Location 4:56906538-56906560
Sequence AGGTCCTACGTGGGTATACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974046925_974046928 -5 Left 974046925 4:56906520-56906542 CCAGATAGAGGGAAACAGAGGTC No data
Right 974046928 4:56906538-56906560 AGGTCCTACGTGGGTATACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974046928 Original CRISPR AGGTCCTACGTGGGTATACC AGG Intergenic
No off target data available for this crispr