ID: 974047311

View in Genome Browser
Species Human (GRCh38)
Location 4:56908477-56908499
Sequence CTGGGACGCCGCCTCCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974047303_974047311 -5 Left 974047303 4:56908459-56908481 CCCCCTCCCCACTGGAGGCTGGG 0: 1
1: 0
2: 8
3: 50
4: 463
Right 974047311 4:56908477-56908499 CTGGGACGCCGCCTCCGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 131
974047307_974047311 -8 Left 974047307 4:56908462-56908484 CCTCCCCACTGGAGGCTGGGACG 0: 1
1: 0
2: 3
3: 17
4: 182
Right 974047311 4:56908477-56908499 CTGGGACGCCGCCTCCGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 131
974047300_974047311 1 Left 974047300 4:56908453-56908475 CCTGGACCCCCTCCCCACTGGAG 0: 1
1: 0
2: 5
3: 51
4: 377
Right 974047311 4:56908477-56908499 CTGGGACGCCGCCTCCGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 131
974047306_974047311 -7 Left 974047306 4:56908461-56908483 CCCTCCCCACTGGAGGCTGGGAC 0: 1
1: 0
2: 4
3: 44
4: 381
Right 974047311 4:56908477-56908499 CTGGGACGCCGCCTCCGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 131
974047305_974047311 -6 Left 974047305 4:56908460-56908482 CCCCTCCCCACTGGAGGCTGGGA 0: 1
1: 0
2: 4
3: 65
4: 434
Right 974047311 4:56908477-56908499 CTGGGACGCCGCCTCCGCGCTGG 0: 1
1: 0
2: 0
3: 10
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974047311 Original CRISPR CTGGGACGCCGCCTCCGCGC TGG Intronic
900162784 1:1232252-1232274 CTGGGCCGCCGGCCCGGCGCGGG + Exonic
900241063 1:1617680-1617702 CTGGGACGCTGCCTCGAGGCTGG + Intronic
901652593 1:10751785-10751807 CTGGGAGGCCTCCTCTGCCCTGG - Intronic
903603031 1:24556063-24556085 CTGGGATCCCGCCCCCGCCCGGG - Intergenic
903750446 1:25617592-25617614 CTGCGCCCCCGCCTCCTCGCGGG + Exonic
905884555 1:41484777-41484799 CAGGGACACCGCCTCCTCCCCGG + Intergenic
906525583 1:46491357-46491379 CTGGAGCGCAGCCTCAGCGCTGG + Intergenic
909958009 1:81802089-81802111 CTCGGCCGCCGAGTCCGCGCGGG - Intronic
912437369 1:109671222-109671244 CTGGGAGGCCGCATCTGTGCAGG + Intronic
1063458664 10:6202349-6202371 CAGGGAAGCCTCCTCCCCGCGGG + Intronic
1064231054 10:13529229-13529251 CGGGGACGACGCCGCCGCCCGGG + Intergenic
1069521471 10:69124565-69124587 CTCGGACCCCGCCTCTGCGGGGG + Intronic
1072153166 10:92699558-92699580 CAGGGACGCCGCCTCCTCTCGGG - Intergenic
1073412173 10:103351125-103351147 CTCGGACGCCACCACTGCGCAGG + Exonic
1077505689 11:2929076-2929098 CTGGAACGCGGCCATCGCGCTGG - Exonic
1078180116 11:9004165-9004187 CAGCGCCGCCGCCTCCTCGCCGG - Intergenic
1079163169 11:18012968-18012990 CTCGGAGGCCGCCCCCGCGGCGG - Exonic
1081619373 11:44609988-44610010 CTGGGATGCAGCCTCTGAGCTGG + Intronic
1083674520 11:64318092-64318114 CTGGGCCGCCTCCACTGCGCAGG - Exonic
1083746888 11:64741875-64741897 CTGGGACGACGCCTGAGCTCTGG + Intronic
1090744396 11:129694792-129694814 CTGTGACGCCACCTCCTGGCCGG - Intergenic
1091119580 11:133045586-133045608 GTGGGACACCGCCTCCCCGCTGG + Intronic
1091225873 11:133956340-133956362 CTGGGAGGCGGCCGCCGGGCAGG + Intronic
1091289417 11:134429173-134429195 CTGGGCAGCCGCCTCTGGGCTGG - Intergenic
1095206276 12:39443321-39443343 CTGGGAGGCCGCGTCCCCACCGG - Intronic
1096336927 12:50763987-50764009 CTATGGCGCTGCCTCCGCGCGGG - Intronic
1103474804 12:121210426-121210448 CTGGGCCCCAGCCGCCGCGCCGG + Intronic
1103828970 12:123763347-123763369 CTCGAAAGCCGCCTCCTCGCAGG + Intronic
1104773918 12:131381475-131381497 CTGGGAAGCAGCCTCCCCACCGG + Intergenic
1106516957 13:30464707-30464729 CTGCGCCGCCGCCGCCGCGAGGG + Intronic
1110705950 13:78602197-78602219 CCGGGCCGCCGCCGCCGCCCGGG + Exonic
1117913804 14:60657129-60657151 CTTGGGCGCCGCGTCTGCGCCGG + Intronic
1118351002 14:64972369-64972391 CTGCGCCGCCGCCGCCGCCCCGG + Intronic
1119469040 14:74882128-74882150 CTGGGACGCGGAGGCCGCGCGGG + Intronic
1121562193 14:94884161-94884183 CTGGGATGCCCCCTCTGAGCTGG - Intergenic
1121645751 14:95516424-95516446 CGGGGCCCCCGCCCCCGCGCCGG + Intronic
1122697352 14:103562546-103562568 GTGGGGCACCACCTCCGCGCGGG - Intronic
1122742643 14:103881052-103881074 ATGGGACGCCCCCTCCTCCCTGG + Intergenic
1122947731 14:105020863-105020885 CCCGGGCGCCGCCTCCGCCCCGG + Intronic
1125284003 15:38072990-38073012 CAGGGACGCTTCCTCCCCGCCGG + Intergenic
1130112461 15:80977087-80977109 CTGGGCCCCAGCCTCCCCGCTGG + Exonic
1130362889 15:83207460-83207482 CCGGGAGGCCGCCCCCCCGCGGG + Exonic
1130527076 15:84716390-84716412 CTGGGTCGCCGCCTCGGTGAAGG - Intronic
1132155372 15:99492259-99492281 CTGGAAGGCAGCCTCCGTGCTGG + Intergenic
1132466005 16:77761-77783 CTGGGAGGCCGCCCCAGCCCTGG - Intronic
1132665340 16:1078901-1078923 CTGGAACGCCTCCTCCCCGGGGG + Exonic
1133069611 16:3236055-3236077 ATGGGACTCCGCCCCCGCTCTGG + Intronic
1135586899 16:23678647-23678669 CTGGGTCTCCGCATCCACGCCGG + Intronic
1135752207 16:25066723-25066745 CTGCGGCGCCGCCTGCCCGCTGG - Intergenic
1138561277 16:57802284-57802306 TTGGGGCGCCGCGTCCGGGCCGG - Intronic
1141608771 16:85169935-85169957 GTGGAACGTCGCCTACGCGCTGG + Intergenic
1142211907 16:88812383-88812405 CAGGCCCGCCGCCTCCGCCCTGG - Intergenic
1142231110 16:88900720-88900742 CAGGGACGCTGCCACCCCGCCGG + Intronic
1142377008 16:89711617-89711639 CTGGGACCCTCCCTCCTCGCAGG + Intronic
1142417209 16:89949184-89949206 CGGGGACGCCGCCGCTGCTCCGG + Intronic
1142852503 17:2711137-2711159 CTGGGAGGCCGCCGCGGAGCAGG + Intronic
1143444096 17:6996953-6996975 CGGGAAGGCCACCTCCGCGCAGG - Exonic
1147891520 17:43720758-43720780 CTGGGCCTCCGCCTCCGTGCTGG + Intergenic
1148356381 17:46978544-46978566 CTCTGCCGCCGCCTCCGGGCGGG - Exonic
1149512632 17:57256264-57256286 AGGGGACCCCGCCTCCGGGCCGG - Intronic
1150764360 17:67992010-67992032 CTGAGAGGCCGCCTCCGTCCAGG - Exonic
1152321468 17:79610617-79610639 CAGGGACCCCGACCCCGCGCAGG + Intergenic
1152775880 17:82201704-82201726 CTATGACGCCGCCTTCGCCCAGG - Exonic
1157586428 18:48804245-48804267 CTGGGCTGCAGCCTCCGCCCTGG - Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1160706306 19:531784-531806 CTGCGCCGCCGCCGCCGCCCGGG - Exonic
1160948458 19:1654376-1654398 CTGTGGCCCCGCCTCCCCGCCGG - Intergenic
1161048853 19:2151461-2151483 CTTGGACCCCGCCGCCGCCCTGG - Exonic
1161574877 19:5049645-5049667 CTGGGGCCCCGCCTCAGCCCTGG - Intronic
1161911426 19:7197439-7197461 CTGGGACCCCGCCTCCTTCCGGG - Intronic
1162424634 19:10587109-10587131 CAGGGGCGACCCCTCCGCGCGGG - Intronic
1163118064 19:15200148-15200170 CTGGGACCCCGCCCCTGCGCGGG - Intronic
1166702743 19:44891533-44891555 CTGGGAGGCAGCCTGGGCGCCGG + Exonic
1167439675 19:49500895-49500917 CGGGGACGCTGCCTCCCCGTGGG + Intergenic
1168538534 19:57191744-57191766 CAGGGCCGCCGCCTCCTCGGTGG - Exonic
1168538544 19:57191784-57191806 CGGGGCCGCCGCCTCCTCGGTGG - Exonic
925027434 2:621011-621033 CAGGTACGACGCCTCCCCGCAGG + Intergenic
928904728 2:36356660-36356682 CTGCGCCGCCCCCTCGGCGCTGG + Intronic
929775538 2:44928952-44928974 CCGGGACGCGGTCTCCGGGCGGG + Intergenic
932611410 2:73202845-73202867 CTGGGAGGCCGCCGGCGCGCAGG - Exonic
934296834 2:91749089-91749111 CCGGGGCGCCGCCGCGGCGCTGG - Intergenic
938487334 2:131724140-131724162 CTGGGAGGCGGCCTGGGCGCCGG - Intronic
945953378 2:216062094-216062116 CTGGGATGGCGCCTCCAGGCTGG - Intronic
1172771394 20:37384475-37384497 CGGGGTCGCCCCCTCTGCGCAGG + Intronic
1173809545 20:45947761-45947783 CTGGGGCTCCTCCTCCCCGCAGG - Exonic
1178914580 21:36699385-36699407 CAGCGCCTCCGCCTCCGCGCCGG + Exonic
1179209562 21:39313631-39313653 CTGGACCGACGCCTCCGCGGGGG + Exonic
1179495230 21:41767055-41767077 CTGGGCAGCCGCCGCGGCGCTGG - Exonic
1180177890 21:46098869-46098891 CTGGGACTCCGCCGGGGCGCTGG + Intronic
1181048276 22:20226874-20226896 CTGGGATGACCCCTCCTCGCCGG - Intergenic
1182222981 22:28773113-28773135 CAGGGGCGCGGGCTCCGCGCCGG + Intronic
1184407728 22:44309385-44309407 CTGGGCCGCTGCCTACCCGCAGG - Intronic
1185079405 22:48701440-48701462 CTGGGACCCTGCCTGCCCGCTGG + Intronic
953748712 3:45594074-45594096 CTCGGCCGCCCCCTCCGCCCCGG + Intronic
961816925 3:129555917-129555939 CTGGGCTGCAGCCTCCGGGCTGG + Exonic
966878893 3:184338662-184338684 CCGGGAGGCCGCCCCCGTGCCGG + Intronic
968293490 3:197556033-197556055 CCGAGCCGCCTCCTCCGCGCTGG + Intronic
968478747 4:824949-824971 CTGGAGCGGCGCCTCCGCGGTGG + Intronic
969715944 4:8868197-8868219 CTCCGACGCCTCCTCCGTGCCGG + Exonic
969720787 4:8892336-8892358 CTGGGTCTCCGCGTCCTCGCTGG + Intergenic
974047311 4:56908477-56908499 CTGGGACGCCGCCTCCGCGCTGG + Intronic
976398536 4:84582994-84583016 CTGGGCTCCCGCCGCCGCGCAGG - Exonic
985462658 4:190121627-190121649 GACGGACGCCGCCGCCGCGCAGG - Intergenic
985565280 5:612324-612346 CTCGGACGGCGCCTGCGCGGCGG - Exonic
986000838 5:3629483-3629505 CTGGGATGCAGTCTCCACGCGGG + Intergenic
986152507 5:5140340-5140362 CAGCGACTCCGCCGCCGCGCCGG - Exonic
997870008 5:137498638-137498660 CGGGGTCCCCGCCTCCGGGCTGG - Intronic
999248314 5:150167089-150167111 CTGGGCCGCCGCCTACGGCCCGG + Exonic
1001640232 5:173238811-173238833 CTCCGCCTCCGCCTCCGCGCTGG + Intergenic
1001928740 5:175658160-175658182 CGCGGCCGCCGCCTCCCCGCGGG + Intronic
1003524478 6:6886370-6886392 CTGGGATGCAGCCTCGGAGCAGG - Intergenic
1004690224 6:17987282-17987304 CGCGGACGCCGCCTCCGCCCCGG + Intronic
1007902045 6:45422031-45422053 CCGCGCCGCCGCCTCCGCGGCGG - Intronic
1010889681 6:81291229-81291251 CTGTGAGGCCTCCTCCGTGCTGG - Intergenic
1017696419 6:157021051-157021073 GAAGGACGCCGCCGCCGCGCAGG - Intronic
1018091003 6:160347421-160347443 CTGGGACGCCTTCCCCGGGCTGG - Intergenic
1019359424 7:596994-597016 GTGGGCCGCCGCCCCCGCACAGG + Intronic
1019471452 7:1223691-1223713 CTGGGAGGACCCCTCCGCCCAGG + Intergenic
1020037667 7:4974450-4974472 CACGGACACCGCCTCCGCGGCGG - Intergenic
1020106160 7:5423267-5423289 CCGGGGCGCCCCCTCCCCGCCGG + Intronic
1020162151 7:5781174-5781196 CACGGACACCGCCTCCGCGGCGG + Intronic
1035496844 7:159335364-159335386 GTGGGACGGCGGCTCCGCGAGGG + Intergenic
1035567974 8:654401-654423 CTGGGACGGGGCCTCCTCGAGGG + Intronic
1035751845 8:2002045-2002067 CTGCGCCGCCGCCTGCGCGCCGG + Exonic
1039542294 8:38382206-38382228 CTCGGCCTCCGCCTCCGTGCTGG + Exonic
1048981211 8:139704034-139704056 CCGGGAGGCGGCCGCCGCGCTGG + Intergenic
1049200418 8:141337323-141337345 TTGGGCCGCAGCCTCGGCGCTGG - Intergenic
1051235373 9:14993375-14993397 CTGCGGCCCCGCCCCCGCGCCGG - Intergenic
1053050513 9:34957894-34957916 CCGGGCCGCCTCCTCCGGGCGGG + Intronic
1055638049 9:78297076-78297098 ATGGGGCGCCGACTCGGCGCAGG + Intergenic
1056954487 9:91071411-91071433 CTGGGAAGCTGCCTCCCCTCTGG + Intergenic
1057203425 9:93156178-93156200 CTGGGCTGCCCCCTCTGCGCAGG - Intergenic
1057489094 9:95508175-95508197 CTGCGACGCCGCCTTCGCTCTGG - Exonic
1060829627 9:126705541-126705563 CGAGGACGCCGCCTCCGCAGAGG + Intergenic
1060917149 9:127398055-127398077 CTGGGGGGCCGCCTCCTCACCGG + Exonic
1061680952 9:132242163-132242185 CTCGGACGCCGGCCCCGCCCCGG - Exonic
1062026942 9:134344878-134344900 ATGGGACGCAGCCTCTGTGCGGG + Intronic
1192206098 X:69097425-69097447 ATGGGAGGCCGCCTCTGCGCAGG + Intergenic
1197726086 X:129777469-129777491 CAGGGACGCAGCCGCTGCGCAGG + Intergenic
1197792410 X:130268887-130268909 CTGAGACGCCGGTTCCGCGCTGG - Exonic
1200098202 X:153673901-153673923 CTGCGGCGCCGCGGCCGCGCTGG - Intronic
1201145959 Y:11065903-11065925 CTGGGATGGCGCCTCAGTGCAGG - Intergenic