ID: 974047347

View in Genome Browser
Species Human (GRCh38)
Location 4:56908612-56908634
Sequence GGAGGGCCGCGGGCCGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 751
Summary {0: 1, 1: 0, 2: 10, 3: 72, 4: 668}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
974047347_974047366 12 Left 974047347 4:56908612-56908634 CCCGCGCCGGCCCGCGGCCCTCC 0: 1
1: 0
2: 10
3: 72
4: 668
Right 974047366 4:56908647-56908669 CCAGGGCCTCTCCCTGTCGCCGG No data
974047347_974047367 16 Left 974047347 4:56908612-56908634 CCCGCGCCGGCCCGCGGCCCTCC 0: 1
1: 0
2: 10
3: 72
4: 668
Right 974047367 4:56908651-56908673 GGCCTCTCCCTGTCGCCGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 98
974047347_974047356 -5 Left 974047347 4:56908612-56908634 CCCGCGCCGGCCCGCGGCCCTCC 0: 1
1: 0
2: 10
3: 72
4: 668
Right 974047356 4:56908630-56908652 CCTCCTGGCCCCCTCCCCCAGGG No data
974047347_974047354 -6 Left 974047347 4:56908612-56908634 CCCGCGCCGGCCCGCGGCCCTCC 0: 1
1: 0
2: 10
3: 72
4: 668
Right 974047354 4:56908629-56908651 CCCTCCTGGCCCCCTCCCCCAGG 0: 1
1: 0
2: 7
3: 152
4: 1098

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
974047347 Original CRISPR GGAGGGCCGCGGGCCGGCGC GGG (reversed) Intronic
900092193 1:925339-925361 GGGAGGCTGCGGGGCGGCGCGGG + Intronic
900126725 1:1072034-1072056 GCAGGGTCCCGGGCGGGCGCGGG + Exonic
900349556 1:2228175-2228197 GGCGGGCCGGGGGCCGGCGGCGG + Intergenic
900607883 1:3531823-3531845 GGGGGGCCGCGGGGCGGGGGAGG + Intronic
900629228 1:3624969-3624991 GGCGGTCCGCGGGGCGGGGCCGG + Intergenic
900643264 1:3697350-3697372 GAAGGGCCGAGGGCCTGTGCAGG - Intronic
901012821 1:6210835-6210857 GGAGGGCCTCAGGCCGGTGGAGG - Intronic
901022243 1:6261256-6261278 GGCCGGCCGCGGGCGGACGCGGG - Intergenic
901086124 1:6613477-6613499 GGAGGTGCGGGGGCCCGCGCCGG - Intronic
901110009 1:6786075-6786097 GGAGAGCAGGGGGCCGGCGAGGG - Intronic
901381851 1:8879291-8879313 GGAGGGCAGCGCGCAGGCGCAGG - Intergenic
901455738 1:9361820-9361842 GGAGGGTGGCGGGCAGGCCCGGG - Intronic
901506613 1:9689527-9689549 GGAGGGGCGCGGCCCGGGGCGGG - Intronic
901886969 1:12230174-12230196 GGCGGCCCGCGGGTCCGCGCCGG - Intronic
902410043 1:16207088-16207110 GGAGGGGCCGGGGCCGCCGCGGG - Exonic
903597094 1:24503063-24503085 GGAGGGCAGCGGACGGGCCCGGG - Exonic
903925192 1:26826836-26826858 GGCGGGCAGCGGGGCGGCCCCGG - Exonic
903935117 1:26890098-26890120 GGCGGCCCGCGGCCCGGAGCAGG + Exonic
903950629 1:26994074-26994096 GGGGGGCCGCGCGCTGGAGCTGG + Exonic
904483295 1:30807393-30807415 GGCGGGCGGCGGCCCGGGGCGGG - Intergenic
904500227 1:30908831-30908853 GGAGGGGCCCGGGGCGGGGCGGG + Intergenic
904618875 1:31763900-31763922 GCAGGAGCGGGGGCCGGCGCTGG + Exonic
904641956 1:31937946-31937968 GGCGGCCCCCGCGCCGGCGCCGG - Intronic
904830990 1:33306741-33306763 GGAGGGCCGGGAACCGGCGGCGG + Intergenic
905028370 1:34866041-34866063 GGAGAACCGCGGGCCCGGGCCGG + Exonic
905075769 1:35269120-35269142 GGCGGGGCGCGGCCCGGGGCCGG + Intronic
905463087 1:38134040-38134062 GGAGGGCCCAGGGCCGGGGTGGG + Intergenic
905553209 1:38859961-38859983 GGAGGGCTGAGGGCCCGAGCCGG - Intronic
905670709 1:39788594-39788616 GGCGGGCGGCGGGGCGGGGCGGG + Exonic
905847089 1:41242166-41242188 GGAGAGCGGCGGGCGGGCGGCGG + Intergenic
906027137 1:42682941-42682963 GGAGGGGCGCGCGGCCGCGCGGG - Intronic
906116092 1:43358474-43358496 GGAGAGCCGCGGGCGGCAGCGGG - Intergenic
906130762 1:43453852-43453874 GGCGGGCGGCGGGCGGGGGCGGG + Exonic
906637160 1:47417142-47417164 AGCGGGCAGCGGGCCGGGGCCGG - Exonic
908354539 1:63317479-63317501 GGGAGGCCGAGGGCGGGCGCGGG + Intergenic
908523517 1:64966567-64966589 GGCCGGCCGCGGGGCGGGGCGGG - Intergenic
909957741 1:81800889-81800911 GGAGGGGCGCGAGCTGGCGCAGG + Intronic
910449079 1:87328809-87328831 GGAGGAGCGCGGGCGGGGGCGGG + Exonic
910760819 1:90729617-90729639 GCAGGGCCGCGGGTCACCGCAGG + Intergenic
911144806 1:94541825-94541847 GGAGCGGCGGGGGCGGGCGCCGG - Intergenic
912174658 1:107141154-107141176 GGGGAGTGGCGGGCCGGCGCTGG + Intronic
912385986 1:109271382-109271404 GGAGGGCTGCAGGCCCGAGCTGG - Exonic
912486681 1:110034737-110034759 GGGGCACCGCGGGCCGCCGCGGG + Exonic
912492622 1:110070473-110070495 CGCGGGCCGCGGGGCGGCGCGGG + Exonic
912910931 1:113758953-113758975 GGAGGGGCAGGGGCCGCCGCTGG + Intronic
914116667 1:144747386-144747408 GGAAGGCCTGGGGCCGCCGCGGG - Intergenic
914226204 1:145721265-145721287 GGAGTGACGCGGGCCAACGCGGG + Intronic
915161378 1:153922858-153922880 GGAGGGGGGCGGGCCGGACCGGG + Exonic
915246297 1:154558478-154558500 GGGGGGCCAGGGGGCGGCGCCGG - Exonic
915559224 1:156676759-156676781 GGAGGCCCGCGGGGCGGCGCGGG + Exonic
916144448 1:161726743-161726765 GGAGGCCCGCGGCGCGGCGCTGG + Exonic
916414097 1:164576639-164576661 GGGGAGCCTCGGGCCGCCGCCGG - Intronic
918071352 1:181135253-181135275 GGAGGGAGGCGAGCCGGAGCAGG + Intergenic
920184594 1:204152087-204152109 AGCGGCCCGCGGGCCGGGGCGGG - Intergenic
920603701 1:207357568-207357590 GGAGGGCGGAGGGCGGGCGGGGG + Intronic
921029695 1:211326748-211326770 GGAGGGGCGCGGGCGGGCGCAGG - Intronic
922496574 1:226062411-226062433 GCAGGGCCGGGGGCGGGGGCTGG + Intronic
922602877 1:226870569-226870591 GGCGGGGCCTGGGCCGGCGCCGG + Exonic
922648659 1:227318280-227318302 GGAGGGAGGCGGCCCGGCGCAGG + Exonic
922730516 1:227946843-227946865 GGAGGGCGGCGGCCCGGCTGAGG + Intronic
922753711 1:228082773-228082795 CGAGGGGCGCGGGCCGGTGTGGG + Intronic
922796172 1:228340894-228340916 GGAGGGCCAGGGGCCGGGGCCGG + Intronic
922804151 1:228377085-228377107 GAAGGCCAGCGGGCGGGCGCTGG + Exonic
923008199 1:230068067-230068089 GGAGGGCCGGGGGCCGGGTTGGG - Intronic
923141421 1:231163539-231163561 GCAGGGCCGCGGGGCCGTGCCGG + Exonic
923171409 1:231421343-231421365 GTTGGGCCGCAGGCCGCCGCCGG + Exonic
923684147 1:236142409-236142431 GGGGGCGCGCGGGCCGGGGCGGG + Intergenic
923859979 1:237883657-237883679 GGAGGGCCGGGGGAGGGCGGGGG + Intronic
924436843 1:244049348-244049370 GGAGGGCGGCGGGCTGGGGGAGG + Intronic
1063504152 10:6580568-6580590 GGAGGGCGGCGAGGCGGAGCAGG + Intergenic
1064645416 10:17454474-17454496 GGCGCTCCGCGGGCCGGGGCCGG - Intergenic
1065214721 10:23438938-23438960 GGCGGGGCGCGGGCCGGAGTGGG + Intergenic
1065373807 10:25016619-25016641 GGAGGCACGCTGGCCGCCGCAGG + Intronic
1066022952 10:31320169-31320191 GGGGCGCGGCGGGGCGGCGCGGG + Intronic
1066235388 10:33480452-33480474 GGAGTGCCGGGGGACGGCGCTGG - Intergenic
1066464219 10:35639484-35639506 GGCGGGCCGGGGGGCGGCGGCGG - Exonic
1067214736 10:44292949-44292971 GGAGGGCCGCGGGTGGGAGGCGG + Intronic
1067214778 10:44293049-44293071 GGAGGGCCGCGGGTGGGAGGGGG + Intronic
1067375867 10:45727322-45727344 TGAGGGCGGCGGGCCGGAGAGGG + Intronic
1069664610 10:70146213-70146235 GGACGCCCGCGGGACGGGGCAGG + Exonic
1071497551 10:86179279-86179301 GGAGGGCTGCAGTCCGGGGCTGG - Intronic
1072783983 10:98268224-98268246 GGGGGGCCGCGGGCGGGAGGCGG - Exonic
1073147949 10:101292600-101292622 GCGCGGCCGCGGGCCGGAGCGGG - Intergenic
1073432231 10:103494102-103494124 GCAGGGCCCTGGGCCGGGGCCGG - Exonic
1074121685 10:110498092-110498114 GCGGGGCCGCTGGCCGGCGGCGG + Exonic
1074377487 10:112951624-112951646 GGCGGGCAGCGGGCGGGGGCCGG - Intronic
1075090981 10:119444110-119444132 GGAGGCCCACGGGCAGGGGCCGG - Intronic
1076362680 10:129900527-129900549 GGAGGACCTTGGGCCGGTGCTGG - Intronic
1076374241 10:129972844-129972866 TGGGGGCCGCGGGCTGGGGCGGG + Intergenic
1076722204 10:132397562-132397584 GGCGGGCGCCGGGCCGGGGCGGG + Intronic
1076804796 10:132849956-132849978 GGCGGGCCGCGTGCTGGGGCGGG + Intronic
1077028104 11:450649-450671 GGGCGGCCGCGGGGCGGCGAGGG + Intronic
1077048053 11:554929-554951 GGGAGGGCGCGGGCGGGCGCCGG - Exonic
1077105840 11:842356-842378 CGTGGGGCGCGGGCCGGGGCTGG - Intronic
1077210812 11:1370233-1370255 GGAGGGCAGCGGGCGGGGGGAGG - Intergenic
1077227567 11:1445080-1445102 GGAGGGCGCCGGCCCAGCGCAGG + Intronic
1077253779 11:1571863-1571885 GGCGGGGCGGGGGCGGGCGCCGG - Intronic
1077297487 11:1832811-1832833 GGAGTGCCGCTGGCCGGCCGCGG + Intronic
1077404604 11:2377482-2377504 GGCGGCGGGCGGGCCGGCGCGGG - Exonic
1077495906 11:2886296-2886318 GGAGGCCCACGGGCGAGCGCGGG - Intergenic
1077505778 11:2929481-2929503 GGTGGCCCGAGGGCCGGGGCGGG - Intergenic
1077662771 11:4084296-4084318 GGAGGGCAGAAGGCCGGGGCTGG + Intronic
1077956946 11:7031036-7031058 AGAGGGCTGCGGGCCAGCGTGGG - Intronic
1078139543 11:8682397-8682419 GGAGGTGCGCGGGGCGGCTCAGG + Exonic
1078375900 11:10792725-10792747 GCAGGGCTGCGGGGCGGGGCAGG + Intergenic
1081705580 11:45180666-45180688 GGCGGGCGGGGGGCGGGCGCTGG + Intronic
1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG + Exonic
1081938163 11:46918646-46918668 GGAAGGGGCCGGGCCGGCGCTGG - Intergenic
1083258070 11:61508775-61508797 GGAGGCCCGAGGGCGGGCGGTGG + Intergenic
1083609676 11:63998924-63998946 GGCGGGCCGTGGGGCGGCGCGGG + Intronic
1083686641 11:64380488-64380510 GGGGAGCCGCGGGCAGGCACGGG + Intergenic
1083728884 11:64642749-64642771 CCAGGGCCGGGGGGCGGCGCGGG + Intronic
1083939978 11:65890606-65890628 GGCGGGGCGCGCGCCGGGGCGGG - Exonic
1084171228 11:67401883-67401905 GCGGGGCCGCGGGCCGGGGGCGG - Intronic
1084175718 11:67421223-67421245 GGCGGGGCGCGGGGCGGGGCTGG + Intronic
1084212441 11:67630274-67630296 GGAGGGCGGCGGGGCGGGGCGGG + Intergenic
1084295828 11:68213105-68213127 GGAGGGGCGGGCGCCGGCGAGGG - Intronic
1084336501 11:68460876-68460898 CGAGGCGCGCGGGCAGGCGCGGG + Intronic
1084419953 11:69055394-69055416 GGAGAGCAGCGGCCAGGCGCTGG - Intronic
1084770405 11:71339451-71339473 GGAGGGCCGGAGGCAGGCGCGGG - Intergenic
1084946683 11:72642473-72642495 GGCGGGGGGCGGGCCGGGGCGGG - Intronic
1084946692 11:72642488-72642510 GGCGGGCCGGGGGCGGGCGGGGG - Intronic
1084951481 11:72668576-72668598 GGCTGGCCGAGGGCCGGCCCTGG - Intronic
1084978093 11:72814282-72814304 GGAGGACCGAAGGCCGACGCCGG - Intergenic
1085474808 11:76783229-76783251 GGCCGGCCGCGGGGCGGCTCAGG - Intronic
1085785048 11:79441089-79441111 GCAGGGCCGCACTCCGGCGCGGG + Intergenic
1089384386 11:118058416-118058438 GGAGGGGCGCAGGCCTGGGCAGG + Intergenic
1089479036 11:118790788-118790810 GGAGCCCCCCGGGCCGGCTCTGG - Intronic
1090279671 11:125445163-125445185 GGAGGGCCGCGGGAAGGGCCAGG + Intergenic
1090327779 11:125904188-125904210 GGCGGGCCGCGGGGCGGCGCGGG + Intronic
1090385540 11:126355866-126355888 GGGGGCCCGCGGGGCGGGGCGGG + Intronic
1091238568 11:134037398-134037420 GGAGGGCGGTGGGCGGGAGCTGG + Intergenic
1091252174 11:134153466-134153488 GGAGGTCTGAGGGCCGCCGCTGG - Intronic
1091434057 12:460002-460024 GGAGGCAGGCGGGCGGGCGCCGG + Intergenic
1091616077 12:2052547-2052569 GGGGGGCTGCAGGCCGGCGCGGG + Intronic
1092045948 12:5431993-5432015 GGCGCGGCGCGGGCCGGCGGGGG + Intergenic
1092572459 12:9739937-9739959 GGAGGGGCGCGGGCGGGAACCGG - Intergenic
1092743208 12:11649780-11649802 GGAGAGCCGCGGGAGGGCGGGGG + Intergenic
1092861902 12:12725649-12725671 GAGGGGCCCCGGGCGGGCGCGGG - Intergenic
1093228336 12:16513358-16513380 GGAGGGCAGTGGGCAGACGCAGG - Intronic
1094494561 12:30981251-30981273 GGAGGGCCGGGTGCTGGCCCTGG - Intronic
1095180867 12:39145255-39145277 GGAGTGCCCCGAGCCAGCGCCGG + Intergenic
1095752977 12:45730360-45730382 GGCAGGGCGCGAGCCGGCGCCGG - Intronic
1096523769 12:52198726-52198748 GGAGGGCCGAGGGGCAGCACAGG + Intergenic
1097192535 12:57226316-57226338 GGAGGGGGGCGGGCAGGGGCAGG - Exonic
1098342956 12:69470555-69470577 GGACGGCCGCGGGCCCGCGTCGG + Intronic
1098991179 12:77065844-77065866 GGGGCGGCGCGGGGCGGCGCGGG + Intergenic
1099365185 12:81759148-81759170 GGGGGGCCGGGGGACGGCGTGGG - Intronic
1100078884 12:90824062-90824084 GGAGAGGCGCGGGCGGGAGCCGG + Intergenic
1100611507 12:96194821-96194843 GGTGGGCTGCGGGCCGGGGTGGG + Intronic
1101705976 12:107221619-107221641 GGCGGGCGGCGGGGCGGCGGGGG + Intergenic
1102278330 12:111599320-111599342 GGAGGGAGGGGGGCCGGGGCCGG + Exonic
1103509713 12:121466564-121466586 TGCGAGCCGCGGGCCGGCGCGGG - Intronic
1103678745 12:122676958-122676980 GGAGGGGCGCGGGCGGGAACCGG - Intergenic
1103800254 12:123533455-123533477 GGAGGAGCGGGGGTCGGCGCTGG - Exonic
1104961518 12:132490419-132490441 GGCGGGCGGCGGGCCGGGCCGGG - Exonic
1105454195 13:20525629-20525651 GGAGGACCGGAGGCCGGGGCGGG + Intronic
1105472081 13:20703763-20703785 GGGGGCGCGCGGGCCGGCGCCGG + Intronic
1105557364 13:21459419-21459441 CGCGGGCCGCGGGCCGCCCCCGG + Intergenic
1106810026 13:33350210-33350232 GGAGGGCGGCGGGCCCGGGCGGG + Intronic
1106995889 13:35478911-35478933 GGAAGGACGCGGGCCTGCGAGGG + Intronic
1107624876 13:42272121-42272143 GGAGGGCTGGGGGTCAGCGCGGG + Intergenic
1108373366 13:49792359-49792381 GAGGGGCGGGGGGCCGGCGCCGG - Intronic
1112183869 13:97110104-97110126 GCAGGGCCGTGGGACCGCGCCGG - Intergenic
1112402037 13:99086191-99086213 GGACGACCGCGGGCCGGGGGAGG - Intronic
1113231674 13:108218719-108218741 GGAGGGTCGCGGGGAGCCGCCGG + Intronic
1113841482 13:113363956-113363978 GGGGGGTCGCGGGCCCGCGCGGG + Intronic
1113874259 13:113584798-113584820 GGAGAGGCGCGGGCTGGGGCCGG - Exonic
1114418086 14:22557329-22557351 GGAGGGCCTGGGGCCTGGGCCGG + Intronic
1116820271 14:49620776-49620798 GGAGGGCCGCGGTGTGCCGCGGG + Exonic
1117302165 14:54440918-54440940 GCAGGGCCGCGGGCCGGCAGAGG + Intronic
1118339300 14:64880511-64880533 GGAGGGCAGGGGGCGGGCACTGG + Intergenic
1120852009 14:89180078-89180100 TGAGGGCCGCAGGCTGGCGGTGG + Intronic
1121595198 14:95157130-95157152 GGAGGCCCGCGTGCCGGCCATGG - Intronic
1122263826 14:100537752-100537774 GGAGTTCCACGGGCCGGGGCCGG + Exonic
1122265797 14:100546353-100546375 GGCGGGGCGAGGGCCGGGGCGGG - Intronic
1122265806 14:100546370-100546392 GGCGGGGCGAGGGCCGGGGCGGG - Intronic
1122265815 14:100546387-100546409 GGCGGGGCGAGGGCCGGGGCGGG - Intronic
1122265824 14:100546404-100546426 GGCGGGGCGAGGGCCGGGGCGGG - Intronic
1122265833 14:100546421-100546443 GGCGGGGCGAGGGCCGGGGCGGG - Intronic
1122265842 14:100546438-100546460 GGCGGGGCGAGGGCCGGGGCGGG - Intronic
1122265851 14:100546455-100546477 GGCGGGGCGAGGGCCGGGGCGGG - Intronic
1122265860 14:100546472-100546494 GGCGGGGCGAGGGCCGGGGCGGG - Intronic
1122275122 14:100587208-100587230 GGAGGGCAGGGCGCGGGCGCGGG - Intronic
1122367458 14:101202638-101202660 GTAGGCCCACGGGCAGGCGCTGG + Intergenic
1122543273 14:102509398-102509420 GGAGGGTCGCGGGGCCGAGCGGG + Intronic
1122666676 14:103334690-103334712 GGCGGACGGCGGGCGGGCGCGGG + Intronic
1122688717 14:103521785-103521807 GGCGGGCCGAGGGGCGGCGGCGG - Intronic
1122692445 14:103537695-103537717 GGAGGGCAGCAGGCCGGTGGGGG + Intergenic
1122779186 14:104136483-104136505 GGCGCGCCGCGGGGCGGCTCGGG - Intergenic
1122883374 14:104699938-104699960 GGAGGGCTGAGGGGCGGTGCGGG + Intronic
1122904484 14:104795550-104795572 GCATCCCCGCGGGCCGGCGCTGG + Intronic
1122908701 14:104815826-104815848 GGAGGCCCAGGAGCCGGCGCCGG - Intergenic
1122931107 14:104933439-104933461 GGAGCGCGGCAGCCCGGCGCGGG - Exonic
1122960971 14:105093511-105093533 CGCGGGCCGGGGGCGGGCGCTGG - Intergenic
1122978002 14:105178902-105178924 GGAGGGCCGGCGTCCCGCGCAGG + Intronic
1123004445 14:105314667-105314689 GGAGGGCGCCGGGCGCGCGCGGG + Exonic
1123020565 14:105396003-105396025 GGTGGGCCTCGAGCCGGGGCTGG + Exonic
1123684488 15:22787174-22787196 CGAGGGCTGCCGGGCGGCGCGGG - Intronic
1124109525 15:26773146-26773168 GGAGGAGCGCGCGCGGGCGCGGG + Intronic
1125328938 15:38564289-38564311 GGAAGTCGGCGGGCGGGCGCCGG + Intronic
1126034975 15:44537256-44537278 GGCAGGGCCCGGGCCGGCGCCGG + Intronic
1126777607 15:52112808-52112830 CGGGGGCCGGGGGCCGGGGCGGG - Intergenic
1127103251 15:55588258-55588280 GGAGGCTCGCGGCCCGGCCCTGG + Intronic
1127293695 15:57591933-57591955 GGGGCGACGCGGGACGGCGCCGG - Exonic
1127342794 15:58065434-58065456 TGAGGGCTGCGGGACGGGGCCGG - Intronic
1127753625 15:62068648-62068670 CGAGGGCCGCGGCCGGGAGCGGG + Exonic
1128454894 15:67826909-67826931 GGAGGGCCCGGTGGCGGCGCCGG + Exonic
1129196899 15:73973748-73973770 GGAGAGCCGCGGGCGGGAACCGG + Intergenic
1129724427 15:77894333-77894355 GGAGAGGCGCGGGCCGGAACCGG - Intergenic
1130540385 15:84817463-84817485 GGAGGGCCCCCAGCCGGGGCTGG + Exonic
1131053306 15:89361932-89361954 GGAGGGCCGCAGGGCTGCTCTGG + Intergenic
1131071577 15:89469861-89469883 GGAGGGGAGGGGGCCAGCGCTGG - Intergenic
1131830943 15:96354282-96354304 GGAGGGGCGGGGGCGGGAGCCGG - Intergenic
1132055643 15:98648862-98648884 GGCCGGGCGGGGGCCGGCGCGGG + Intergenic
1132480668 16:164878-164900 GGCGGGGCGCGGGGCGGGGCGGG + Intronic
1132480698 16:164936-164958 GGCGGGGCGCGGGGCGGGGCGGG + Intronic
1132484122 16:181376-181398 TGAGGGCCGCGGGACGCCCCGGG + Intergenic
1132498838 16:275877-275899 GGGCGGCCGGGGGGCGGCGCGGG + Exonic
1132589684 16:721214-721236 CGAGGGCCGCGGACCCGAGCCGG + Exonic
1132729213 16:1352315-1352337 GGAGCGCTGTTGGCCGGCGCGGG + Intronic
1132742253 16:1420650-1420672 GGAGGGCCGAGGGCAGACACCGG - Intronic
1132851590 16:2027226-2027248 GGCGGGCCGGGGGCGAGCGCTGG - Intronic
1132893370 16:2215243-2215265 GGAGCGCCGCGGGAGGGGGCCGG + Intergenic
1132897742 16:2236960-2236982 GGTGGGGCCCGGGCCGGGGCGGG + Exonic
1132989443 16:2785418-2785440 GCCGGGCGGCGGGCGGGCGCCGG + Exonic
1133049113 16:3106645-3106667 TGAGGGCGGCGGGGCGGGGCTGG + Intergenic
1133156542 16:3880386-3880408 GGCGGGCCGCGGGCCGGGAGCGG - Exonic
1133784445 16:8963625-8963647 GCGGGGCCGCGGGCCGGCCGGGG + Intronic
1134070270 16:11256084-11256106 GGCGGGGCGCGGGACGCCGCGGG + Exonic
1134648320 16:15888599-15888621 GCAGGGCCGCGGTGCGGCCCTGG - Exonic
1136402121 16:30024750-30024772 GGAGGCCCGAGGGCCAGCGGGGG + Exonic
1136588512 16:31202811-31202833 GGAGGGCAACGGACCGGGGCGGG - Exonic
1136778974 16:32885547-32885569 GGGGGGCTGCGGTCAGGCGCGGG + Intergenic
1136891644 16:33975971-33975993 GGGGGGCTGCGGTCAGGCGCGGG - Intergenic
1137280582 16:46973388-46973410 GGCTGCCCGCGAGCCGGCGCCGG - Intronic
1137645024 16:50066233-50066255 GGAGGACGACGGGCCGGCGGCGG + Exonic
1137734251 16:50712275-50712297 GCAGGGCCACGGGCCGCCGGAGG - Exonic
1138106625 16:54290492-54290514 GGTGGGCCCCGGGCCAGTGCTGG + Intergenic
1138417577 16:56880034-56880056 GGAGGGCACCGAGCCGGGGCTGG + Intronic
1138555201 16:57766842-57766864 GGAGGGCTGGGGGTGGGCGCTGG - Intronic
1138686976 16:58734240-58734262 GGAGGGCAGTGGGCAGCCGCAGG + Exonic
1139368731 16:66451380-66451402 GGAGGGCTGAGGGCCTGCACAGG - Intronic
1139748055 16:69090262-69090284 GGAGGGCAGAGGGCCAGCACGGG - Intergenic
1139954404 16:70686278-70686300 CGAGGGTCGGGGGGCGGCGCTGG + Intergenic
1140096951 16:71883785-71883807 AGAGGGCCGGGGGCCAGCTCCGG - Intronic
1140442638 16:74999303-74999325 GGCGAGCGGCGGGCGGGCGCGGG - Exonic
1142179832 16:88662987-88663009 TGAGTGCCGCGGGCCGGCCTGGG - Intronic
1142348312 16:89568325-89568347 AGAGGGCCCAGGGCCGGGGCTGG - Intergenic
1142395266 16:89828361-89828383 GGAGGGACGCGGGGCGGGGCGGG - Intronic
1203081385 16_KI270728v1_random:1147636-1147658 GGGGGGCTGCGGTCAGGCGCGGG + Intergenic
1142638160 17:1270514-1270536 AGAGGGCAGAGGGCCGGGGCTGG + Intergenic
1142670624 17:1485927-1485949 GGGGGTCCGCGGGCCGGGGGCGG + Intronic
1143524144 17:7462696-7462718 GGAGGGCCTCCGTCCGGCCCGGG + Exonic
1144758642 17:17694816-17694838 GCGGGGCCGCGGGGCGGGGCGGG + Intronic
1144759794 17:17700818-17700840 AGATGGCCGGGGGACGGCGCGGG - Intronic
1144784417 17:17823801-17823823 GGTGGGGCGGGGGCCGGGGCCGG - Intronic
1144806617 17:17972184-17972206 TGAGGACCGCGGGCCTCCGCCGG - Intronic
1145907552 17:28524630-28524652 GAAGGGCCCAGGGCCGGGGCCGG - Exonic
1146054649 17:29575026-29575048 GGAGGGCCTCGAGCTGGGGCAGG - Intronic
1146183062 17:30709422-30709444 GGAGCGCCCCGAGGCGGCGCCGG - Intergenic
1147000621 17:37359411-37359433 GGCGGGCCGCGGGCGGGCCGCGG + Intronic
1147000626 17:37359422-37359444 GGCGGGCCGCGGGCGGGCCCTGG + Intronic
1147139678 17:38454013-38454035 CGGGGGCCGGGGGCTGGCGCTGG + Intronic
1147392987 17:40121838-40121860 CGGGGGCCGGGGGCCGGCGAGGG - Intergenic
1147757890 17:42780540-42780562 GGCGGGCCGCGGGGCGGCGACGG + Intergenic
1147758939 17:42785216-42785238 ATAGGGCCGCGGGCCGCGGCGGG + Intronic
1148081053 17:44967908-44967930 GTCGGTCCGCGCGCCGGCGCCGG + Exonic
1148146899 17:45371775-45371797 GGTGGGCGGCGGGCAGGCGAGGG - Intergenic
1148262052 17:46192943-46192965 GGAGAGCGGCGGGCCCGGGCCGG - Intronic
1148323760 17:46771873-46771895 GCAGGGGCGGGGGCGGGCGCCGG - Intronic
1148419248 17:47531646-47531668 GGCGGGCCTCGGGTCGGGGCTGG + Intronic
1148438286 17:47698694-47698716 GGAGGGGCGGGGGCTGGCGGTGG - Exonic
1148912375 17:50949741-50949763 GGAGGGCCCAGGGCCTGGGCTGG + Intergenic
1150135877 17:62694905-62694927 GGAGGGCGACGGGCAGGGGCAGG - Intergenic
1150217078 17:63476916-63476938 GCAGGGGCGCGGGCCGGGGAGGG - Intergenic
1150747176 17:67825617-67825639 GGAGGCCCGCGGGGCCGGGCGGG - Intronic
1150830121 17:68511883-68511905 GGAGGGCCCCGGGCCGGGGCGGG - Intronic
1151334653 17:73432678-73432700 GGAGGGCTGGGGGCTGGGGCAGG + Intronic
1152023973 17:77796868-77796890 GGAGGGGCCAGGGCCGGGGCAGG + Intergenic
1152069801 17:78128834-78128856 GGGGCGCCGCGGGCCGGGCCGGG - Intronic
1152111626 17:78360234-78360256 GGCGGGCCGCGAGCAGGGGCAGG + Intergenic
1152209477 17:78995376-78995398 GGAGGGCAGCCGGCCGGCCCTGG - Intronic
1152245611 17:79183225-79183247 GCCGGGCCGGGGGCCGGGGCCGG + Intronic
1152414099 17:80147656-80147678 GGTGGGCCCCGGCGCGGCGCTGG + Intergenic
1152463859 17:80455043-80455065 GGAGGGCGGCGGGCCGGGGCGGG - Intergenic
1152663384 17:81553176-81553198 GGAGGGAGGCGGGCCGGGGGCGG - Intronic
1152861550 17:82699077-82699099 GGAGGGGCGAGGGGCGGTGCAGG + Intergenic
1152936536 17:83140429-83140451 TGAGGGCCGCGGGCCCTCGCTGG + Intergenic
1203162198 17_GL000205v2_random:62945-62967 GGAGGGCCTCGGGCCAGCTAGGG - Intergenic
1153688395 18:7567918-7567940 CGAGGCGCGCGGGCCGGCGCGGG + Intronic
1156118966 18:33820253-33820275 GGTGGGCGCCGGCCCGGCGCGGG - Intergenic
1156118978 18:33820281-33820303 GGTGGGCGCCGGCCCGGCGCGGG - Intergenic
1156118990 18:33820309-33820331 GGTGGGCGCCGGCCCGGCGCGGG - Intergenic
1156119002 18:33820337-33820359 GGTGGGCGCCGGCCCGGCGCGGG - Intergenic
1156119014 18:33820365-33820387 GGTGGGCGCCGGCCCGGCGCGGG - Intergenic
1156119026 18:33820393-33820415 GGTGGGCGCCGGCCCGGCGCGGG - Intergenic
1156119038 18:33820421-33820443 GGTGGGCGCCGGCCCGGCGCGGG - Intergenic
1156119050 18:33820449-33820471 GGTGGGCGCCGGCCCGGCGCGGG - Intergenic
1156119062 18:33820477-33820499 GGTGGGCGCCGGCCCGGCGCGGG - Intergenic
1156119074 18:33820505-33820527 GGTGGGCGCCGGCCCGGCGCGGG - Intergenic
1156119086 18:33820533-33820555 GGTGGGCGCCGGCCCGGCGCGGG - Intergenic
1157354000 18:46917143-46917165 GGAGGGGAGCGGGCCGGCGGAGG - Intronic
1157492958 18:48136825-48136847 GGGTGGCCGCGGGGCGGCTCTGG - Intronic
1157529507 18:48409427-48409449 GGAGGGCGGAGGCGCGGCGCGGG - Intronic
1158954057 18:62523285-62523307 GGAGGGCCGGGGCCGGGGGCGGG - Exonic
1160163324 18:76491547-76491569 GGGGGGCGGGGGGCGGGCGCCGG + Intronic
1160163713 18:76493335-76493357 GGGGGGGCGGGGGCCGACGCAGG + Intronic
1160256369 18:77251248-77251270 GGAGGGCGGAGGGCCGGTGGGGG + Intronic
1160443551 18:78911463-78911485 GGAGGGCCTGGGGCTGGAGCTGG - Intergenic
1160443582 18:78911546-78911568 GGAGGGCCTGGGGCTGGAGCTGG - Intergenic
1160443694 18:78911874-78911896 GGAGGGCCTGGGGCAGGAGCTGG - Intergenic
1160465148 18:79069706-79069728 TGAGGGCCGCGGGCAGCTGCCGG + Intronic
1160544035 18:79641084-79641106 GGGGTGCCGGGGGCCGGGGCAGG - Intergenic
1160567756 18:79797896-79797918 GGCGGTGCGCGGGGCGGCGCCGG + Intergenic
1160668413 19:344470-344492 GGAGGGACGCGGGGCGGGGCTGG - Intronic
1160853596 19:1206166-1206188 TGGGGGTCGCGGGCCGGCTCGGG + Intronic
1160858529 19:1227918-1227940 GCGGGGCCGCCGGACGGCGCTGG - Exonic
1160960627 19:1719113-1719135 GCAGGGCCGCGGTCCCGCGTGGG - Intergenic
1161037847 19:2095552-2095574 GGAGGGCAGCGGGCAGGGCCAGG + Intronic
1161234409 19:3190723-3190745 GGGGGGCCGGGGGCGGGCCCCGG - Intronic
1161318016 19:3627256-3627278 AGAGGGCAGAGGGCGGGCGCGGG + Intergenic
1161400247 19:4064135-4064157 AGAGGCCCGCGGGCGGCCGCAGG - Intronic
1161412415 19:4123877-4123899 GGGGCTCCGCGGGCCGGCGGCGG + Exonic
1161608758 19:5229469-5229491 GGTGGGCGGGGGGCCGGGGCGGG - Exonic
1161610133 19:5237834-5237856 GGAGGGAAGGGGGCCGGCGGGGG + Intronic
1161959548 19:7516194-7516216 GGGGAGCCGGCGGCCGGCGCGGG + Exonic
1162019606 19:7862660-7862682 GCGGGGCCGCGGGCGGGGGCGGG - Intronic
1162019675 19:7862830-7862852 GCAGGACCGCGGGCAGGGGCGGG - Intronic
1162046848 19:8005644-8005666 TCCGGGCCGCGGGCCGGAGCGGG - Intronic
1162372683 19:10288766-10288788 GGAGAGCCACGGGCAGGGGCGGG + Intergenic
1162778591 19:12995395-12995417 GGAGGGGCGCGGGGAGGGGCGGG - Intergenic
1162832980 19:13298671-13298693 CGAGGGCAGCCGGCCGGCCCGGG - Exonic
1162901068 19:13795732-13795754 GCAGCGCCTCGGGCCGGCCCCGG - Exonic
1162935240 19:13978706-13978728 GGGGGGCAGCGGGCGGGCGGGGG - Intronic
1162940369 19:14005847-14005869 GGAGGTCGGCAGGCCGGGGCGGG - Intronic
1162949489 19:14062080-14062102 GGGGGGCTGCGGGCGGGCACCGG + Intergenic
1162975733 19:14206346-14206368 GGAGCGCCCCGAGGCGGCGCCGG + Intergenic
1163025125 19:14506375-14506397 GGAGGGCCACGGGACGGCAGCGG + Intergenic
1163117206 19:15195864-15195886 GGCGGGGCGCGGGCTGGGGCTGG - Intronic
1163304901 19:16471880-16471902 GGCGGGCCTGGGGGCGGCGCCGG - Intronic
1163304981 19:16472098-16472120 GGAGGGGCGGGGGCAGGGGCGGG + Intergenic
1163615265 19:18323287-18323309 GGAGCAACGCGCGCCGGCGCGGG + Intergenic
1163630919 19:18417618-18417640 GCAGGGCCTCGGGCTGGCGACGG - Intergenic
1163729613 19:18941353-18941375 GGAGGGGCGGGGGCCGGGACTGG + Intergenic
1164639314 19:29812515-29812537 TGAGGCCTGCGGGGCGGCGCGGG - Exonic
1165040553 19:33064965-33064987 GAAGGGCCGCGGGACGGGGTGGG - Intergenic
1165204612 19:34172821-34172843 AGGAGGCCGCGGGCCGGAGCGGG - Intronic
1165896706 19:39145786-39145808 GGTGGGCAGTGGGCGGGCGCAGG - Intronic
1166126368 19:40717354-40717376 GGCCGGCCTCGGGCCTGCGCCGG + Exonic
1166721798 19:45001420-45001442 GGCGGGCGGCGGGCGGGGGCGGG - Exonic
1166798980 19:45444326-45444348 GGAGGGGCGCGGGCCGGCCTTGG - Intronic
1166831510 19:45642296-45642318 GGACGACCGCGTGTCGGCGCTGG - Exonic
1167072376 19:47228357-47228379 GAAGGGGCGCGGGCCGTCGCGGG + Exonic
1167101611 19:47407316-47407338 GAGGGCCCGCGGGCCGGCCCGGG - Intronic
1167414137 19:49361588-49361610 GGAGGGGCGGGGCCCGGTGCCGG - Intronic
1167577665 19:50325550-50325572 GGTGGGCTGGGGGCCGGCGCAGG + Intronic
1168078487 19:53992921-53992943 GGGGGGCCGCGGGCCGGCGGCGG + Exonic
1168318269 19:55493741-55493763 GGAGGGGCGCTGGCCGCCCCCGG + Exonic
1168344314 19:55642939-55642961 GGTGTGCGGCGGCCCGGCGCGGG - Exonic
1168581635 19:57559897-57559919 AGAAGGCAGTGGGCCGGCGCAGG - Intergenic
1168717588 19:58538500-58538522 GGGGGGCCGCGCGCCCGGGCTGG + Intronic
1168728656 19:58606927-58606949 AGGGGGCGGCGCGCCGGCGCAGG - Intergenic
1168728664 19:58606957-58606979 AGGGGGCGGCGCGCCGGCGCAGG - Intergenic
1168728687 19:58607047-58607069 AGGGGGCGGCGCGCCGGCGCAGG - Intergenic
1168728695 19:58607077-58607099 GGGGGTCGGCGCGCCGGCGCAGG - Intergenic
1168728706 19:58607111-58607133 GGGGGTCGGCGCGCCGGCGCAGG - Intergenic
1168728714 19:58607142-58607164 GGGGGTCGGCGCGCCGGCGCAGG - Intergenic
1168728729 19:58607180-58607202 GGGGGTCGGCGCGCCGGCGCAGG - Intergenic
1168728737 19:58607211-58607233 GGGGGTCGGCGCGCCGGCGCAGG - Intergenic
925288560 2:2731301-2731323 GGAAGGCCGCCGGACGGTGCGGG - Intergenic
925730534 2:6917319-6917341 TCCGGGCCTCGGGCCGGCGCAGG + Intergenic
926035241 2:9630911-9630933 GGAAGCCCGCGGGCCGACCCAGG + Intronic
926249641 2:11147049-11147071 GGAGGGCCAGGGACCAGCGCCGG + Intergenic
926423327 2:12718805-12718827 AGAGGGCGGCGGGACTGCGCGGG + Intronic
926758155 2:16252424-16252446 GGAGGCCCCCGGGCCACCGCCGG + Intergenic
927137381 2:20106865-20106887 GGAGAGGCGCGGGCGGGAGCCGG - Intergenic
927567259 2:24123740-24123762 GGAGGCCCCCGGCCCGGGGCTGG + Intronic
927881436 2:26692644-26692666 GGGGGGCGGGGGGCGGGCGCGGG + Intergenic
928103651 2:28453670-28453692 GGAGGGCCTGGGGCAGGCTCTGG + Intergenic
929133505 2:38602169-38602191 GGAGGGTCGCGGCGCGGCGGCGG - Intronic
929857845 2:45651228-45651250 GGAGCGCGGAGGGCGGGCGCCGG + Intergenic
929936406 2:46297313-46297335 GGAGGGCGGGGGGCGGGCACCGG - Intronic
929966763 2:46542637-46542659 GGAGGGGCCCGGGTTGGCGCGGG + Intronic
930136359 2:47906540-47906562 GGAGGGCCGCGGGGCGGCGGGGG + Intergenic
930198263 2:48530033-48530055 GGAGGGGCGGGGGCGGGGGCGGG + Intronic
931348952 2:61471225-61471247 GGAGGGCGGCGAGCCGGCCACGG - Intergenic
931602671 2:64019451-64019473 GGAGGGCCGCGGCCCGGGCCGGG + Intergenic
931682917 2:64768003-64768025 AGAGGGGCGCGGGCCAGGGCGGG - Intergenic
932257785 2:70302018-70302040 GGAGCGCCGCGGGGCAGCGCGGG - Exonic
932493732 2:72136554-72136576 GGAGGGCAGGAGGCCGGCGAGGG + Intronic
932798155 2:74715604-74715626 GGAGGGCGGCCGGCGGGCTCAGG - Intergenic
934085089 2:88503138-88503160 GGAGAGGCGCGGGCCGGAACCGG + Intergenic
934661417 2:96145527-96145549 TGAGGGGCGGGGGCGGGCGCGGG - Intergenic
934750363 2:96789936-96789958 GGAGGGCCGGGGGCGGGGGGTGG - Intronic
934763716 2:96869355-96869377 GGAGGGCCGCGGTCCACGGCTGG - Intronic
935046677 2:99489657-99489679 GGACGGCCGCGGGCCGGGGCCGG + Intronic
935396950 2:102619505-102619527 GGCGGCCCGCGGGCGGGGGCGGG - Intergenic
936370403 2:111898384-111898406 GGCGGGCCGAAGGCCGCCGCTGG - Intergenic
937716280 2:125037335-125037357 GGAGAGGCGCGGGCGGGAGCTGG + Intergenic
937956256 2:127423194-127423216 GGCGGGCGGCGGGGCGGGGCTGG + Intronic
938338901 2:130522737-130522759 GGAGGGCCACGGGCCGCGGGGGG + Intronic
938350937 2:130598013-130598035 GGAGGGCCACGGGCCGCGGGGGG - Intronic
938931236 2:136088383-136088405 GGAGAGGCGCGGGCGGGAGCAGG - Intergenic
940036799 2:149320365-149320387 GGTGGCCTGGGGGCCGGCGCGGG - Intergenic
940774936 2:157875866-157875888 GGCGCGGCGCGGGGCGGCGCGGG + Intergenic
941951328 2:171160252-171160274 GGAGGCCCGCGAGCGGGCGCGGG + Intronic
941979086 2:171434731-171434753 GGAGGGCCGCGGGCGCGCGGCGG + Exonic
944766713 2:202871703-202871725 GGAGGGCCGGGAGTCGGCGCGGG - Intronic
944831265 2:203535530-203535552 GGAGGGCGGAGGGCCGGCGCGGG - Intergenic
946250105 2:218406461-218406483 GGGGGGCCGAGCCCCGGCGCCGG - Intergenic
946418350 2:219551727-219551749 GGTGGGCCGCCGGGCGGTGCTGG - Exonic
947596061 2:231412428-231412450 GCAGGGCCGCGGGTCGGGGCGGG + Intergenic
947623462 2:231605009-231605031 GGAAGGCTGCGGGCCCGGGCGGG + Intergenic
948393332 2:237627561-237627583 GGAGGGGCCGGGGCCGGGGCCGG + Intronic
948393388 2:237627753-237627775 GGAGGGCAGCCGGGGGGCGCCGG + Intronic
948393394 2:237627764-237627786 GGGGGGCGCCGGGCGGGCGCGGG + Intronic
948487207 2:238288583-238288605 CGAGGCCCGCGCGCCGGCGGCGG + Exonic
948874669 2:240820256-240820278 GGAGGGGCGCGGGGCGGTCCGGG - Exonic
948991740 2:241559091-241559113 GGGCGGCCCCGGGCCGGGGCGGG + Intronic
949032194 2:241802469-241802491 GGAGGGCTGTGGGCAGGCACAGG + Intronic
1168769762 20:407963-407985 GGTGGGCCGGGGGCCGGGGCCGG - Intronic
1168777846 20:462562-462584 GCAGGGTCACGTGCCGGCGCGGG - Intergenic
1168795887 20:610053-610075 GGCGGGCGGCGGGCGGGCGGCGG - Exonic
1169118651 20:3082902-3082924 GGGGGGACGCGGGCCTGCGGCGG - Intronic
1169132537 20:3173556-3173578 GGAGGGGCGCGGAGCGGAGCCGG - Intronic
1169327259 20:4686402-4686424 GGAGGGACGCGGGGCGGGGAAGG - Exonic
1169327302 20:4686529-4686551 GGAGGAACGCGGGCGGGGGCAGG + Intronic
1169367281 20:5001558-5001580 GGTGGGCCCCAGACCGGCGCGGG - Intronic
1171041989 20:21773085-21773107 GGATGGCTGAGGGCCAGCGCAGG + Intergenic
1171175653 20:23049513-23049535 GGCGCGCCGCGTGCAGGCGCCGG + Exonic
1171284185 20:23924084-23924106 GGATGGCTGCGGGCCTGGGCTGG + Intergenic
1172037012 20:32018189-32018211 GGAGGGGCGGGGGCGGGGGCGGG + Intronic
1172037027 20:32018212-32018234 GGAGGGGCGGGGGCGGGGGCGGG + Intronic
1172118038 20:32583476-32583498 GGAGGGAGGGAGGCCGGCGCGGG + Intronic
1172618695 20:36306382-36306404 GGGCGCCCGCGGGCCGGAGCCGG + Exonic
1172961734 20:38805246-38805268 GGAGGTCCAGGGGCCGGCCCTGG - Intergenic
1173548000 20:43914380-43914402 GGGGGGACGCAGGCCAGCGCCGG - Intergenic
1174317350 20:49713353-49713375 GGTGGGCCGGAGGCTGGCGCGGG + Intronic
1175517256 20:59577480-59577502 GGAGGGCCGCGGAGCGGAGCCGG - Intergenic
1175735995 20:61387803-61387825 GCAGGGCCACGGGCCGGTGCGGG - Intronic
1175971366 20:62688273-62688295 GGGGGGCCGCGGGCAGGACCTGG - Intergenic
1176029983 20:63007122-63007144 GGGGCGGCGCGGGGCGGCGCGGG + Intergenic
1176234884 20:64049552-64049574 GGAGCGCGGCGGGCGGGCGGCGG + Exonic
1176377867 21:6095689-6095711 GGAGGGCGGCGGGGCAGAGCTGG - Intergenic
1176549057 21:8213694-8213716 GGAGGGGCACGGGCCGGGGGCGG - Intergenic
1176556951 21:8257914-8257936 GGAGGGGCACGGGCCGGGGGCGG - Intergenic
1176567989 21:8396732-8396754 GGAGGGGCACGGGCCGGGGGCGG - Intergenic
1176575893 21:8440951-8440973 GGAGGGGCACGGGCCGGGGGCGG - Intergenic
1178327913 21:31660103-31660125 GGATTGCCGCGGGCCGGGGAGGG + Intronic
1178610405 21:34074050-34074072 GGACTCCCGCGGGCCGGCGCCGG - Intronic
1178914653 21:36699609-36699631 AGTGGGCCGCGGGCAGGTGCGGG - Exonic
1179209357 21:39312961-39312983 GGGGGGCCGGGGGCGGGCGGCGG + Intronic
1179375458 21:40846762-40846784 GGCGGGCGGCGGGCGGGCGGCGG - Exonic
1179522529 21:41954180-41954202 CGCGGCCCGCGGGCAGGCGCCGG - Intergenic
1179745607 21:43442559-43442581 GGAGGGCGGCGGGGCAGAGCTGG + Intergenic
1179775599 21:43659828-43659850 GGCGGGCCGGGGGCCGGGGCTGG + Intronic
1179922599 21:44515320-44515342 GGAGGGCCCTGGGAAGGCGCTGG - Intronic
1180095887 21:45555217-45555239 GGGGCGCCGGGGGGCGGCGCAGG + Intergenic
1180110355 21:45644364-45644386 GGAGAGCCGCGCGCGGGCGGTGG + Intronic
1180178072 21:46099704-46099726 GAAGGGCCGCTGGGCGGGGCTGG - Intronic
1180782400 22:18528601-18528623 GGAGGCGCGCGAGGCGGCGCGGG + Exonic
1180908382 22:19431617-19431639 AGGGGGGCGCGGGCCGGCGATGG - Exonic
1180960560 22:19760629-19760651 GGAGGGGCGAGGGCCGGGGGAGG + Intronic
1181013233 22:20054274-20054296 GGAAGGCCGAGGGCTGGTGCGGG + Intronic
1181125952 22:20702628-20702650 GGAGGTGCGCGAGGCGGCGCGGG + Intergenic
1181239289 22:21467936-21467958 GGAGGCGCGCGAGGCGGCGCGGG + Intergenic
1181282839 22:21731986-21732008 GCAGGGCCTTGGGCCGGGGCCGG - Intronic
1181283402 22:21735758-21735780 GGCGGCCCGCGGGGCGGCGGCGG - Exonic
1181813756 22:25421338-25421360 GGACCGGCGCGGGCCGGGGCAGG - Intergenic
1182036546 22:27202969-27202991 GGAGGGCCGCGGGCTGGGACTGG - Intergenic
1182296166 22:29312090-29312112 GGAGGGTCGGGGGCCCGAGCTGG - Intronic
1182904041 22:33921039-33921061 GGGGGACCGCGAGCCGGGGCTGG + Intronic
1183218016 22:36493747-36493769 GGATGGCCGTGGGCCGAGGCAGG + Exonic
1183590599 22:38777324-38777346 GGAGAGGCGGGGGCCGGCGCTGG - Intronic
1184004764 22:41699897-41699919 GGAGGCCCGCAGGCCGGCCTGGG - Intronic
1184101571 22:42343930-42343952 GGAGGGGCGCGGGCGGGGGCGGG + Intergenic
1184412216 22:44331843-44331865 GGCGGGCGGCCGGGCGGCGCGGG - Intergenic
1184465944 22:44668894-44668916 GGGGGGCCCCGGGGCGGTGCCGG + Intronic
1184552736 22:45213242-45213264 TGAGGGCCGAGGGCTGGGGCTGG - Intronic
1184779667 22:46640813-46640835 GGGGGGCGGGGGGCCGGGGCAGG - Intronic
1184923941 22:47624512-47624534 GAAGGGCCGCTGGCTGGTGCAGG + Intergenic
1185166129 22:49263444-49263466 GGAGGGCGGCGGTGCGGCTCTGG - Intergenic
1185278902 22:49961564-49961586 GGAGCGGCCCGAGCCGGCGCAGG + Exonic
1185397583 22:50600742-50600764 GGCGGGCCGAGCGCCGGCGCGGG + Exonic
1185413478 22:50697717-50697739 TGAGGGGCGCGGGGGGGCGCGGG + Intergenic
1185413674 22:50698431-50698453 GGAGGGGCGCAGGCAGGGGCAGG - Intergenic
1203253944 22_KI270733v1_random:130009-130031 GGAGGGGCACGGGCCGGGGGCGG - Intergenic
1203262000 22_KI270733v1_random:175088-175110 GGAGGGGCACGGGCCGGGGGCGG - Intergenic
950124486 3:10503111-10503133 GGAGGGCAGCGGGACAGCACAGG + Intronic
950153848 3:10708057-10708079 GGAGGGAGGCGGGCGGGCGGCGG - Intergenic
950509983 3:13420267-13420289 GGAGGGCAACGGGGCGGCGCGGG - Exonic
950549031 3:13655335-13655357 GGACGGCCGCGGGCGGGCAAGGG - Intergenic
951543668 3:23806194-23806216 GCAGGGCACGGGGCCGGCGCGGG + Intronic
952334309 3:32391824-32391846 GGCGGGCCGGGGGCGGGCGGGGG - Exonic
952867290 3:37862283-37862305 GGAGGGGCGCAGGCGGCCGCGGG + Intronic
953246722 3:41199844-41199866 GGAGGGCGGCGGCCGGGCCCGGG + Intronic
953423510 3:42773135-42773157 GGAAGGGCCCGGGCCGGAGCTGG - Intronic
954093090 3:48301119-48301141 GGAGGGCGGCGGCCCAGCCCTGG + Intronic
955161474 3:56468448-56468470 GGAGGGCCAGGGCCAGGCGCGGG + Intergenic
956761227 3:72446962-72446984 GGGGAGCCGCGGGCCGGATCTGG + Intergenic
959592034 3:108091471-108091493 GGAGAGACGCGGGCTGGGGCGGG - Intergenic
960269451 3:115658531-115658553 GCACGGCCGCGAGCCCGCGCGGG - Intronic
960575622 3:119226769-119226791 GGAGGGTCGAGGGCAGGCCCTGG + Intronic
960864218 3:122184069-122184091 CGAGGGCCACAGGCCGGCTCGGG - Intronic
961028917 3:123585122-123585144 CCAGGGCCGCGGGGCGGAGCCGG + Exonic
961182409 3:124887137-124887159 GGCGGGGCGCGGGCCAGCGCGGG - Exonic
961475352 3:127142554-127142576 GGAGGGCCCCAGGCCGGGGAGGG + Intergenic
961612579 3:128152916-128152938 GGAGGGCGGGGGGACGGCGGGGG - Intronic
962520739 3:136195839-136195861 GGAAGTGCGCGGGCCGCCGCCGG + Exonic
963870307 3:150408734-150408756 GAAGGTCCGCGGGCGGGCGGTGG - Exonic
963870316 3:150408759-150408781 CGGGAGCCGCGGGCCGGAGCTGG - Exonic
965521214 3:169669379-169669401 GGAGCGCCCCGGGGAGGCGCGGG + Intergenic
965757435 3:172040366-172040388 GGAGGGTCCCGAGCCCGCGCCGG + Intronic
966886470 3:184380221-184380243 GGAGGGCGGAGGGCCGGGCCGGG - Exonic
966919271 3:184601771-184601793 GGTGGGTCGGGGGCCGGCTCGGG - Intronic
967055189 3:185824600-185824622 GGAGGGGAGCGGGCCGTCCCAGG + Intronic
968092858 3:195909242-195909264 TGGGGGCCGCCGGACGGCGCGGG - Intronic
968506531 4:973591-973613 CGCGGGCCGCGGGGCGGGGCGGG + Intronic
968510050 4:991655-991677 GCAGGGCAGAGGGCCGGTGCCGG - Exonic
968514842 4:1011703-1011725 GCGGGGCCGGGGGCCGGGGCCGG - Intronic
968514972 4:1012001-1012023 GGAGGGCGGGGGTCCGGGGCGGG + Intronic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
968565315 4:1309552-1309574 GGATAGCCCCGGGCCAGCGCTGG + Intronic
968616385 4:1579419-1579441 GGAGGGCGGGGGGGTGGCGCAGG - Intergenic
968619804 4:1599019-1599041 GGAGGGAAGCGGGCCGGGGAAGG - Intergenic
968661797 4:1801745-1801767 TGAGGGCCCTGGGGCGGCGCGGG + Intronic
968831352 4:2934322-2934344 CGCGGGGCGCGGGCCGGGGCTGG - Exonic
968957270 4:3725810-3725832 GGAGGGCCGGGGGCTGGCTCCGG - Intergenic
968976024 4:3822414-3822436 GGCAGGCTGCGGGCCGGTGCGGG - Intergenic
969636984 4:8374987-8375009 GCAGGGCCGCGTGGCGGCTCAGG + Exonic
970188193 4:13484396-13484418 GCGGGGCCGCCGGTCGGCGCGGG - Intergenic
971757437 4:30721339-30721361 GGAGGGCAGGCGGCCGGCCCCGG + Exonic
972960646 4:44448413-44448435 GCAGGGCCCCGGGGCGGCGGCGG + Exonic
973293378 4:48490873-48490895 GGAGGGGCCCGGGCCCGCGGCGG + Exonic
973894292 4:55396369-55396391 GCAGGGCCCCGAGCCGGCCCGGG + Exonic
974047347 4:56908612-56908634 GGAGGGCCGCGGGCCGGCGCGGG - Intronic
977221301 4:94340627-94340649 GGAGGGGGGCGGGCCGGGCCCGG - Intronic
978361073 4:107931682-107931704 GGAGGCGCGCGGGCCAGGGCGGG - Exonic
978944771 4:114482041-114482063 GGAGAGGCGCGGGCAGGAGCCGG - Intergenic
979780912 4:124650744-124650766 GGAGAGACGCGGGCAGGAGCTGG + Intergenic
981920129 4:150078216-150078238 AGGGGGCCGAGCGCCGGCGCGGG - Intergenic
985574239 5:666147-666169 GGCTGGGCGCGGGCCGGCCCAGG + Intronic
985702220 5:1380505-1380527 GGAGAGGCGCGGGCGGGAGCGGG - Intergenic
987050211 5:14142907-14142929 GGGGTGACGCGGGCCGGGGCGGG - Intergenic
987082820 5:14441050-14441072 GCCGGGCCGTGGGCTGGCGCCGG + Intronic
989631082 5:43483600-43483622 CCAGGGCCGCGGGACGGTGCCGG + Intronic
990381956 5:55227450-55227472 GGCGGGCCGGGGCCCCGCGCTGG - Intergenic
990743703 5:58937242-58937264 GGAGGGGCGGGGGCGGGAGCAGG + Intergenic
992530098 5:77645231-77645253 GGAGGGGCGCGGGCGGGGGGCGG - Intergenic
993904151 5:93604462-93604484 GGAGGGCCGCGGGGTGGGCCGGG + Intergenic
996373216 5:122775013-122775035 GGAGGCTGGCGGGTCGGCGCGGG + Exonic
997470623 5:134115114-134115136 GGGGTCCCGGGGGCCGGCGCCGG + Exonic
997521288 5:134525902-134525924 GGAGCTCCTGGGGCCGGCGCGGG - Intronic
997903881 5:137794984-137795006 GGAGGGGCGGGGGGCGGGGCGGG + Intergenic
998157687 5:139795857-139795879 GAAGGGACGCGGGCGGGCGCGGG + Exonic
1001199248 5:169700861-169700883 AGAGGGCGGCGGGCGGGGGCAGG + Intronic
1001382261 5:171312395-171312417 CGAAGGCCGCGGGCCAGCGCCGG + Intergenic
1001395890 5:171419575-171419597 GGGGGGCCGGGGGCGGGCCCGGG - Intergenic
1001529921 5:172454541-172454563 GGCGGGCCGGGGGCGGGCGGCGG - Intergenic
1001773373 5:174311861-174311883 GGTGGGCTGCGGCCCGGCGGCGG + Intergenic
1001825602 5:174742787-174742809 GGCGGGCCGGGGGGGGGCGCTGG - Intergenic
1002006537 5:176238775-176238797 GGAGCGCGGCGGGCCGGGGCAGG + Intronic
1002046225 5:176543171-176543193 GGGCGGCCGCGGGCCGGCGGAGG - Intronic
1002190157 5:177473659-177473681 GGAGGGGAGCCGGCCGGCGGGGG + Intronic
1002219841 5:177671861-177671883 GGAGCGCGGCGGGCCGGGGCAGG - Intergenic
1002441271 5:179265683-179265705 GGGTGGGCGGGGGCCGGCGCTGG - Intronic
1002456033 5:179345711-179345733 GAAGCGCCGCGGGCCGGGCCGGG + Intergenic
1002591058 5:180291940-180291962 GGAGCGGGGCGGGCCGGCGGCGG - Exonic
1002662848 5:180803067-180803089 GGAGGGCCGAGGGCAGGGGTGGG - Intronic
1002670420 5:180861627-180861649 GGAGGGGCGCAGGACAGCGCTGG + Intergenic
1002888289 6:1313829-1313851 GCAGGGCTGCGGGCAGCCGCAGG - Exonic
1002897431 6:1388002-1388024 GGAGGGGGGTGGGCCGGGGCTGG - Intergenic
1002924196 6:1595434-1595456 GGATGGCCGCGGGGCCGTGCCGG + Intergenic
1002926766 6:1609681-1609703 GGCGGGCCGGGCGCCGGCGCGGG + Intergenic
1002927832 6:1615004-1615026 TGGAGGCTGCGGGCCGGCGCGGG - Intergenic
1003212310 6:4079044-4079066 CGAAGCCCGCGGGCCGGCGCAGG + Exonic
1003482490 6:6546366-6546388 GGAGAGCCGCGCGCCTGAGCCGG + Intergenic
1003882564 6:10491641-10491663 GGAGAGCCGCGGGCGGGAGCCGG + Intergenic
1003923005 6:10850814-10850836 GGAGGGCCACGGGGCAGGGCTGG + Intronic
1004044741 6:12012605-12012627 GGAGGGCGGCGGGGCGGAGGGGG + Intronic
1004908542 6:20259797-20259819 GGAGGGCGGCGGGGAGGCTCAGG - Intergenic
1006411319 6:33875556-33875578 AGAGGGCCGAGGGCTGGCCCTGG + Intergenic
1006547555 6:34792304-34792326 GGACCGCCGGGGGCCGGCGCTGG - Intronic
1007701920 6:43770787-43770809 GGCGAGCCGCGGGCAGGGGCCGG + Exonic
1007720034 6:43879375-43879397 GGAGGGCCGCAGGCATGCACAGG + Intergenic
1007765026 6:44155075-44155097 GGAGAGCCCCGAGCCGGCCCCGG + Exonic
1007781590 6:44257584-44257606 GCAGCGCCCCGGGCCGCCGCCGG + Intronic
1007788892 6:44297691-44297713 AGAGTCCCGCGCGCCGGCGCAGG + Intronic
1007937072 6:45741901-45741923 GGAGAGGCGCGGGGCGGGGCTGG - Intergenic
1007967515 6:46015955-46015977 GGGGGGCCGTGGCCCGGCCCAGG - Intronic
1011640171 6:89411300-89411322 GGAGACCCGCGGGGCGGCGGGGG - Intronic
1013155735 6:107490051-107490073 GGCGGGCCGGGGGCCGGCGCGGG - Exonic
1013463686 6:110399519-110399541 GGAGGGCCGCGTCCCGGTGAGGG - Intronic
1014550942 6:122789324-122789346 GGAGGGCCGCGGGGCTGACCTGG - Exonic
1015149232 6:130019869-130019891 CGCGGGCCGCGGGCCGGGCCGGG + Intronic
1015251884 6:131135693-131135715 GGCGGGCCGCGTCCCGGGGCTGG - Exonic
1015625984 6:135181425-135181447 GGAGGGACGCAGGCAGGCGGCGG + Exonic
1016923300 6:149317307-149317329 GGGAGGACGCGGGCCGCCGCTGG - Intronic
1018046317 6:159969283-159969305 TGCGGGCGGCGGGCGGGCGCGGG - Exonic
1018400307 6:163414559-163414581 GGAGGGCCGGGGGCGGGCGGCGG - Intronic
1018686358 6:166307579-166307601 CTAGGGCCGCGGGCCCGCGGAGG - Exonic
1018734805 6:166679760-166679782 GGAGCGGCGCGGGCGGGAGCTGG + Intronic
1018876526 6:167826866-167826888 GGCGGGGCGCGGGCGGGTGCGGG + Intergenic
1018961832 6:168454935-168454957 GTGGGGCCGAGGGTCGGCGCTGG + Intronic
1019427520 7:984504-984526 GGCGGGCCCCGGGCAGGAGCTGG + Exonic
1019472812 7:1230223-1230245 GGAGGGGCGGGGGAGGGCGCGGG + Intergenic
1019473394 7:1232960-1232982 GCGGGGGCGCGGGCCGGGGCCGG - Exonic
1019607098 7:1915429-1915451 GCAGGGCCAGGGGACGGCGCAGG + Intronic
1019989667 7:4682605-4682627 GCAGAGCCCGGGGCCGGCGCTGG + Exonic
1020034884 7:4958913-4958935 GGAGGGGCGCGCGGCGGCGGGGG - Intronic
1020066242 7:5190448-5190470 GAAGAGCAGCTGGCCGGCGCCGG - Exonic
1020080257 7:5282887-5282909 GGAGGGGCGGGGCCGGGCGCGGG + Intronic
1021450244 7:20777934-20777956 GCAGGGCAGCGGGCTGGTGCGGG + Intergenic
1021716984 7:23469743-23469765 GCAGAGCCGCGGGCCGGAGTGGG + Intronic
1022100992 7:27169157-27169179 GGAGGTCCCTGGGCAGGCGCAGG + Intronic
1022102981 7:27180186-27180208 GGCGGGCGGCGGGCGGGCGCGGG - Intronic
1022183001 7:27940086-27940108 GGAGGGCAGCAGGCAGGAGCCGG - Intronic
1022443404 7:30451691-30451713 GCAGGGCAGTGGTCCGGCGCGGG - Exonic
1023788182 7:43729265-43729287 GGGAGGCCGCGACCCGGCGCCGG + Intronic
1024089186 7:45921359-45921381 GGAGGGGGGCGGGTCGGCGCAGG + Intronic
1024688804 7:51777457-51777479 GGAGGGGCAGGGGCTGGCGCTGG - Intergenic
1025947423 7:66115103-66115125 GGAGGGCCGCGGGGTGGTGACGG + Intronic
1026458883 7:70596157-70596179 GGCGCTCCGCGGGCCGGGGCGGG + Intronic
1027250097 7:76393564-76393586 AGCGGGCTGCGGGCCTGCGCTGG - Exonic
1028622180 7:92836627-92836649 GGAGGGCGGAGGGACGGCGGAGG + Intergenic
1029453441 7:100655526-100655548 GGAGGGGGGCGGGCTGGAGCTGG - Exonic
1029460927 7:100693748-100693770 GGAAGGCAGCGCGCCGGCCCGGG + Intergenic
1029490569 7:100867934-100867956 GGAGGATCGGGGGCCGGCGTGGG + Exonic
1029630644 7:101748094-101748116 GGTGGGCCGAGGGGCCGCGCTGG + Intergenic
1029640468 7:101816546-101816568 AGGGGGCCGCGGCCCGGCGGTGG + Intronic
1029732415 7:102447051-102447073 GAGGGGCCGAGGGCCGGGGCTGG + Exonic
1030348242 7:108456440-108456462 GCGGGGGCGCGCGCCGGCGCGGG - Intronic
1032013531 7:128361535-128361557 AGAGCGCTGCGGGCCGGGGCTGG - Intronic
1032020719 7:128405982-128406004 GGCGGGCCGGGGGCGGGGGCGGG + Intronic
1032125229 7:129188727-129188749 GCTGGGCCGCGGGCTGGCGCGGG + Intergenic
1032391254 7:131556671-131556693 GGAGGGGCGGGGGCGGGGGCGGG - Intronic
1033253279 7:139778036-139778058 GGGGGGCGGCGGGCGGGGGCGGG + Intronic
1034969592 7:155410801-155410823 GGAGGCCAGAGGGCCGGCCCAGG + Intergenic
1035021319 7:155802862-155802884 GGAGGGGCGCGGGAGGGGGCGGG - Exonic
1035127172 7:156616849-156616871 GACGGGCCGCGGGCAGGAGCGGG - Intergenic
1035168043 7:157003215-157003237 GGAGGCGCAGGGGCCGGCGCAGG + Intronic
1035203243 7:157279697-157279719 GGAGGGCTGCGGGCTGGAGCGGG - Intergenic
1035321931 7:158035525-158035547 GGAGGGCAGGGGGCAGGTGCTGG + Intronic
1035404335 7:158588009-158588031 GGAGGGGCGCGAGCCGGGGCCGG - Intergenic
1036664672 8:10730705-10730727 GGCGGGCCGGGGGCAGGCGCGGG - Intronic
1037803884 8:22049066-22049088 GGAGGGGCCGGGGCCGGGGCCGG + Intronic
1037820673 8:22133309-22133331 GGAGGGCAGCAGGCGGGGGCGGG + Intronic
1037876626 8:22551849-22551871 GCCGGGCCGGGCGCCGGCGCAGG - Exonic
1038761061 8:30384588-30384610 GGAGGAGCGCGGGCCGCGGCTGG - Exonic
1039554780 8:38468053-38468075 CGGGGGCGGCGGGCCGGAGCCGG - Intronic
1039844412 8:41315745-41315767 GGAGGGCAGCGGCCCAGCGCCGG + Intergenic
1040341827 8:46444960-46444982 GCAGGGCCGCAGGCTGGCGTGGG - Intergenic
1040423434 8:47261039-47261061 GGGAAGCGGCGGGCCGGCGCGGG + Intronic
1042837786 8:73093186-73093208 GGAGGGCGGGGGCCGGGCGCAGG - Exonic
1042837854 8:73093362-73093384 GGAGGTCCCCGGGCTGGAGCTGG - Intronic
1042877024 8:73449139-73449161 GGAGGGCGGCGGGCAGGGGCCGG + Intronic
1043527396 8:81111852-81111874 GGAGCGCCGCGCTCCGGGGCTGG - Exonic
1044336012 8:90985312-90985334 GGCGGGCCCAGGGCGGGCGCGGG + Intergenic
1045535238 8:103021298-103021320 GGAGGGACGCGGGTGGGTGCGGG + Intronic
1045678448 8:104633244-104633266 GGAGAGGCGCGGGCGGGAGCCGG - Intronic
1046713388 8:117539646-117539668 GCAGGGCCTGGGGCCGGGGCTGG + Intronic
1047203176 8:122782733-122782755 GGGGGGCCGAGGGCGGCCGCGGG + Intronic
1047381947 8:124372355-124372377 GGAGGGGCGGGAGCCGCCGCGGG - Exonic
1047454644 8:124998227-124998249 GGATGGGCGCGGGCCGGCTCCGG - Intergenic
1047454803 8:124998872-124998894 CGGGGGCTGCGGGCCGGCGCGGG - Exonic
1047732038 8:127736097-127736119 GGACGGCCGGGGCCCGGCGGTGG - Exonic
1048572828 8:135669352-135669374 GGAGGGCCAGGGGCCAGGGCTGG - Intergenic
1048655448 8:136530769-136530791 GGAGAGGCGCGGGCCGGAACCGG - Intergenic
1048972870 8:139655019-139655041 GGATGGCGGGGGGCGGGCGCTGG + Intronic
1049194685 8:141308613-141308635 GGAGGGGCCGGGGCCGGGGCCGG - Intergenic
1049403900 8:142443173-142443195 GGAGGGCCAAGGGCAGGCGCAGG + Intergenic
1049419565 8:142510810-142510832 GCGGGGCGGCGGGCCGGGGCCGG + Intronic
1049532016 8:143159655-143159677 GGTGGGCCTGGGGGCGGCGCGGG + Exonic
1049608479 8:143541097-143541119 GGAGGGCCGCCGCCCCCCGCGGG + Intronic
1049621060 8:143598535-143598557 GTCGGGCAGGGGGCCGGCGCCGG - Exonic
1049661194 8:143820400-143820422 GGAGGGCAGCCGGCCAGGGCGGG - Intronic
1049671406 8:143871723-143871745 AGAGGGACACGGGCCGGCCCCGG + Exonic
1049693559 8:143973148-143973170 GGTGGGCCGCGGGCGGGTGGGGG - Intronic
1049752520 8:144291876-144291898 TGAGGGCAGCGCGCGGGCGCGGG + Intronic
1049776672 8:144409223-144409245 GGAGGGGCGCGGTGCGGGGCCGG - Intronic
1049896133 9:113523-113545 GGGGCGGCGCGGGGCGGCGCGGG + Intergenic
1050533379 9:6609677-6609699 GGAGGGCAGAGGGCGGGAGCAGG - Intronic
1051780466 9:20684020-20684042 GGAGGGCTGCGCGCGGGGGCTGG - Intronic
1052903844 9:33817361-33817383 GGAGGGGGCCGGGCCGGCCCGGG - Intergenic
1053011759 9:34637671-34637693 AGTGGGCCGTGGGCCGGCGGTGG - Exonic
1053221497 9:36316804-36316826 GGAGGGCAGCTGGCAGGGGCAGG + Intergenic
1053409124 9:37904214-37904236 GGCGGGCCGCGGGCCGAGGGAGG - Intronic
1056655135 9:88502850-88502872 GGAGGGCAGCGGGCCCGGGGTGG + Intergenic
1056787933 9:89605920-89605942 GGCTGGCCGCGGGCCGAGGCGGG - Intronic
1056992394 9:91423913-91423935 GGCGGGCCGGGGGCGGGTGCGGG - Intergenic
1057054563 9:91950377-91950399 GCAGGCCCGAGGGCGGGCGCAGG - Intergenic
1057361160 9:94374785-94374807 GGAGCGCCCCGGGCTGGCGCGGG + Exonic
1057432368 9:95005397-95005419 CGAGTTCCGCGGGCGGGCGCGGG + Intronic
1057488922 9:95507323-95507345 GGAAGGGCTCAGGCCGGCGCAGG + Intronic
1057662203 9:97013379-97013401 GGAGCGCCCCGAGCTGGCGCGGG - Exonic
1058967277 9:110049370-110049392 GGAGGGCCGGGCCCCGGCCCCGG + Intronic
1060643990 9:125262236-125262258 GGAGGACCGCGGGGCGGCCTCGG + Intronic
1060991933 9:127854404-127854426 GCAGGGCTGCGGGCGGGCACCGG + Exonic
1060996593 9:127877627-127877649 GGAGGGGTGCGGGTGGGCGCCGG + Exonic
1061128184 9:128689703-128689725 GGCGGCCTGCGGGCCGGGGCGGG - Intronic
1061289266 9:129641648-129641670 GGAGGCCCGCGGGTTGTCGCAGG - Intronic
1061671151 9:132188840-132188862 GGAGGGCCGGGGGCTGGGGCTGG + Intronic
1061680896 9:132242035-132242057 GGCGGGGCGCGGGGCGGCCCCGG - Exonic
1061828489 9:133275709-133275731 GTGGGGCCGCGAGCCGGGGCCGG - Intergenic
1062261227 9:135664114-135664136 GGGGGGCCGCGGGACAGCCCTGG - Intronic
1062305845 9:135906947-135906969 CCAGGGGCGCGGGCCGGGGCCGG - Intronic
1062349265 9:136131203-136131225 GGAGGGCGGAGGGCGGGCCCGGG + Intergenic
1062364730 9:136203219-136203241 GCGGGGCCGCGGGGCGGGGCGGG + Intronic
1062397236 9:136357426-136357448 GGAGGGACGGGAGCTGGCGCAGG - Intronic
1062405178 9:136392813-136392835 CGAGGGCTGCGGGGCGGGGCAGG + Intronic
1062406766 9:136400341-136400363 GGAGGGGCGCGGGTGGACGCGGG + Intergenic
1062448555 9:136606017-136606039 GGAGGGCAGAGAGCCAGCGCTGG + Intergenic
1062457156 9:136645216-136645238 GCAGGGCCCCGGGCCGGGCCAGG + Intergenic
1062556213 9:137114414-137114436 GGGGGGCGGCGGGACGGCGGGGG + Intronic
1062574550 9:137200189-137200211 TGGGGGCCGCGGGCGGGGGCCGG + Exonic
1062596423 9:137301941-137301963 CGCGGGCCGCGGGCCGGGCCGGG + Exonic
1062696226 9:137877670-137877692 GGGCGGCCGCGGGGCGGGGCCGG + Intergenic
1203470344 Un_GL000220v1:113153-113175 GGAGGGGCACGGGCCGGGGGCGG - Intergenic
1203478165 Un_GL000220v1:157125-157147 GGAGGGGCACGGGCCGGGGGCGG - Intergenic
1186795563 X:13044136-13044158 GGAGGGCCGCGGGGTGACACAGG + Intronic
1186821340 X:13291168-13291190 GGGGGGGCGCGGGGGGGCGCGGG - Intergenic
1188003590 X:25002871-25002893 GGAGGGGCGCGGGCAGGGCCCGG + Intergenic
1188242678 X:27809528-27809550 GGCGGGGCGGGGGCCGGCGGCGG - Intronic
1189159896 X:38801172-38801194 GGAGGGGAGCGGGCTGGCCCAGG - Intergenic
1189322317 X:40094468-40094490 GGAGCGCGGGGGGCCGGAGCTGG - Intronic
1192502503 X:71663205-71663227 GGAGGGCTGTGGGCTGGCCCTGG - Intergenic
1192509706 X:71714581-71714603 GGAGGGCTGTGGGCTGGCCCTGG - Intronic
1192511060 X:71720615-71720637 GGAGGGCTGTGGGCTGGCCCTGG + Intergenic
1192515637 X:71760938-71760960 GGAGGGCTGTGGGCTGGCCCTGG - Intergenic
1192516991 X:71766972-71766994 GGAGGGCTGTGGGCTGGCCCTGG + Intronic
1192528845 X:71869692-71869714 GGAGGGCTGTGGGCTGGCCCTGG - Intergenic
1192847733 X:74924147-74924169 GGAAGGCCGTGAGCCGGCGCGGG - Intronic
1192962524 X:76145391-76145413 GGAGGGCCGGGGGAAGGAGCGGG + Intergenic
1192963009 X:76149696-76149718 GGAGGGCCGGGGGAAGGAGCGGG - Intergenic
1194663904 X:96656166-96656188 GGTGAGGCGCTGGCCGGCGCAGG - Intergenic
1195278852 X:103310513-103310535 GGAGGGCCCGGGCCCGGCGTGGG - Intronic
1195625203 X:106999886-106999908 GAAGGCCTGCGGGCCGCCGCCGG + Exonic
1195923295 X:110002971-110002993 GGCGGGCCGCGGGCTGGGGGTGG + Intronic
1196751961 X:119126210-119126232 GGGGGGCCGGGGGGCGGGGCTGG + Intronic
1197754448 X:129984131-129984153 GGCGGGCGGCGGGGCGGGGCCGG + Intronic
1199500393 X:148500745-148500767 GGCTGGCTGCGGGCCGGCGGCGG - Exonic
1199698929 X:150362736-150362758 GGAGGGCCGCAGGCGGGGCCCGG - Intronic
1199699081 X:150363372-150363394 GGCCGGCGGCGGGCGGGCGCGGG + Intronic
1200075747 X:153549764-153549786 GCAGGGCCGGGGGCAGGAGCAGG + Intronic
1200209643 X:154341583-154341605 GGAGGGGCCGGGGCCGGGGCCGG + Intergenic
1200218595 X:154379648-154379670 TCAGGGCCGCGGGCCGGGGAAGG - Intronic
1200221233 X:154390545-154390567 GGAGGGGCCGGGGCCGGGGCCGG - Intronic
1200239514 X:154486448-154486470 GCAGGGCCGAGGGCGGGCACGGG - Intronic
1200384982 X:155881388-155881410 GGAGGGACGCGGGTCAGTGCAGG - Exonic
1200787713 Y:7274315-7274337 GGAGGCGCCCGGGCCGGCCCAGG + Intergenic